"
TopDoc = "\
Please choose one of the following actions:
\
"
TopFooter = ""
}
`SetUpServer' is similar to the previous example, except for calling
another function, `SetUpEliza'. This approach can be used to implement
other kinds of servers. The only changes needed to do so are hidden in
the functions `SetUpServer' and `HandleGET'. Perhaps it might be
necessary to implement other HTTP methods. The `igawk' program that
comes with `gawk' may be useful for this process.
When extending this example to a complete application, the first
thing to do is to implement the function `SetUpServer' to initialize
the HTML pages and some variables. These initializations determine the
way your HTML pages look (colors, titles, menu items, etc.).
The function `HandleGET' is a nested case selection that decides
which page the user wants to see next. Each nesting level refers to a
menu level of the GUI. Each case implements a certain action of the
menu. On the deepest level of case selection, the handler essentially
knows what the user wants and stores the answer into the variable that
holds the HTML page contents:
function HandleGET() {
# A real HTTP server would treat some parts of the URI as a file name.
# We take parts of the URI as menu choices and go on accordingly.
if(MENU[2] == "AboutServer") {
Document = "This is not a CGI script.\
This is an httpd, an HTML file, and a CGI script all \
in one GAWK script. It needs no separate www-server, \
no installation, and no root privileges.\
To run it, do this:
\
- start this script with \"gawk -f httpserver.awk\",
\
- and on the same host let your www browser open location\
\"http://localhost:8080\"
\
\\ Details of HTTP come from:
\
- Hethmon: Illustrated Guide to HTTP\
- RFC 2068
JK 14.9.1997
"
} else if (MENU[2] == "AboutELIZA") {
Document = "This is an implementation of the famous ELIZA\
program by Joseph Weizenbaum. It is written in GAWK and\
/bin/sh: expad: command not found
} else if (MENU[2] == "StartELIZA") {
gsub(/\+/, " ", GETARG["YouSay"])
# Here we also have to substitute coded special characters
Document = ""
}
}
Now we are down to the heart of ELIZA, so you can see how it works.
Initially the user does not say anything; then ELIZA resets its money
counter and asks the user to tell what comes to mind open heartedly.
The subsequent answers are converted to uppercase characters and stored
for later comparison. ELIZA presents the bill when being confronted with
a sentence that contains the phrase "shut up." Otherwise, it looks for
keywords in the sentence, conjugates the rest of the sentence, remembers
the keyword for later use, and finally selects an answer from the set of
possible answers:
function ElizaSays(YouSay) {
if (YouSay == "") {
cost = 0
answer = "HI, IM ELIZA, TELL ME YOUR PROBLEM"
} else {
q = toupper(YouSay)
gsub("'", "", q)
if(q == qold) {
answer = "PLEASE DONT REPEAT YOURSELF !"
} else {
if (index(q, "SHUT UP") > 0) {
answer = "WELL, PLEASE PAY YOUR BILL. ITS EXACTLY ... $"\
int(100*rand()+30+cost/100)
} else {
qold = q
w = "-" # no keyword recognized yet
for (i in k) { # search for keywords
if (index(q, i) > 0) {
w = i
break
}
}
if (w == "-") { # no keyword, take old subject
w = wold
subj = subjold
} else { # find subject
subj = substr(q, index(q, w) + length(w)+1)
wold = w
subjold = subj # remember keyword and subject
}
for (i in conj)
gsub(i, conj[i], q) # conjugation
# from all answers to this keyword, select one randomly
answer = r[indices[int(split(k[w], indices) * rand()) + 1]]
# insert subject into answer
gsub("_", subj, answer)
}
}
}
cost += length(answer) # for later payment : 1 cent per character
return answer
}
In the long but simple function `SetUpEliza', you can see tables for
conjugation, keywords, and answers.(1) The associative array `k'
contains indices into the array of answers `r'. To choose an answer,
ELIZA just picks an index randomly:
function SetUpEliza() {
srand()
wold = "-"
subjold = " "
# table for conjugation
conj[" ARE " ] = " AM "
conj["WERE " ] = "WAS "
conj[" YOU " ] = " I "
conj["YOUR " ] = "MY "
conj[" IVE " ] =\
conj[" I HAVE " ] = " YOU HAVE "
conj[" YOUVE " ] =\
conj[" YOU HAVE "] = " I HAVE "
conj[" IM " ] =\
conj[" I AM " ] = " YOU ARE "
conj[" YOURE " ] =\
conj[" YOU ARE " ] = " I AM "
# table of all answers
r[1] = "DONT YOU BELIEVE THAT I CAN _"
r[2] = "PERHAPS YOU WOULD LIKE TO BE ABLE TO _ ?"
...
# table for looking up answers that
# fit to a certain keyword
k["CAN YOU"] = "1 2 3"
k["CAN I"] = "4 5"
k["YOU ARE"] =\
k["YOURE"] = "6 7 8 9"
...
}
Some interesting remarks and details (including the original source
code of ELIZA) are found on Mark Humphrys' home page. Yahoo! also has
a page with a collection of ELIZA-like programs. Many of them are
written in Java, some of them disclosing the Java source code, and a
few even explain how to modify the Java source code.
---------- Footnotes ----------
(1) The version shown here is abbreviated. The full version comes
with the `gawk' distribution.
File: gawkinet.info, Node: Caveats, Next: Challenges, Prev: Simple Server, Up: Using Networking
2.11 Network Programming Caveats
================================
By now it should be clear that debugging a networked application is more
complicated than debugging a single-process single-hosted application.
The behavior of a networked application sometimes looks noncausal
because it is not reproducible in a strong sense. Whether a network
application works or not sometimes depends on the following:
* How crowded the underlying network is
* If the party at the other end is running or not
* The state of the party at the other end
The most difficult problems for a beginner arise from the hidden
states of the underlying network. After closing a TCP connection, it's
often necessary to wait a short while before reopening the connection.
Even more difficult is the establishment of a connection that
previously ended with a "broken pipe." Those connections have to "time
out" for a minute or so before they can reopen. Check this with the
command `netstat -a', which provides a list of still "active"
connections.
File: gawkinet.info, Node: Challenges, Prev: Caveats, Up: Using Networking
2.12 Where To Go From Here
==========================
Now, you have learned enough to build your own application. You could,
for example, take part in the Loebner Contest to win $100,000. The
Loebner Prize is the first formal instantiation of a Turing Test. Hugh
Loebner agreed with The Cambridge Center for Behavioral Studies to
underwrite a contest designed to implement the Turing Test. Dr.
Loebner pledged a Grand Prize of $100,000 for the first computer whose
responses were indistinguishable from a human's. Each year an annual
prize of $2000 and a bronze medal is awarded to the _most_ human
computer. The winner of the annual contest is the best entry relative
to other entries that year, irrespective of how good it is in an
absolute sense. Here is an example of a conversation with the winning
program of 1997:
(c)1997 Cambridge Center For Behavioral Studies all rights reserved [CONVERSE]
[Intelligent Research Ltd.] Start at: [1997/04/29 08:59:40]
PROGRAM[10:39:20]Hi, my name is Catherine, what's yours?
JUDGE02[10:39:36]My name is Nathan.
PROGRAM[10:39:37]Well, it's nice to meet you, Nathan.
PROGRAM[10:39:45]Did you see that story on CNN last night about the lesbian
PROGRAM[10:40:03]couple who came out at a White House party on Sunday?
JUDGE02[10:40:45]No. I'm sorry I missed that. How did the Prez take it?
PROGRAM[10:40:47]Ellen Degeneres was one of them - she was kissing her lover
PROGRAM[10:41:08]in front of Bill Clinton. Do you think he was very
PROGRAM[10:41:21]embarrassed?
JUDGE02[10:41:37]You tell me. I didn't see it.
PROGRAM[10:41:38]Are you still a Friend of Bill Clinton?
JUDGE02[10:42:22]Yes. I would like to talk about something else. Do you know anything about sculpture.
PROGRAM[10:42:24]Well, I suppose he's doing his best like most of us, but he
PROGRAM[10:42:35]does seem to attract an UNUSUAL amount of bad publicity,
PROGRAM[10:42:51]wouldnt you say--can it all be bad luck?
JUDGE02[10:43:20]I asked you if you knew anything about sculpture.
PROGRAM[10:43:21]OK, but what happens now--does it all drift on, with
PROGRAM[10:43:36]everyone waiting to see how much his friends have said about
PROGRAM[10:43:47]him under threat of lots and lots of jail-or will something
PROGRAM[10:44:01]dramatic actually happen?
JUDGE02[10:44:19]Do you know what sculpture is?
PROGRAM[10:44:20]Well, youre more a fan of his than I am I guess---though I
PROGRAM[10:44:34]cant SWEAR what Id have done in that locked hotel room, I
PROGRAM[10:44:51]must say.
JUDGE02[10:45:26]Have you ever been to the Salmagundi Club?
PROGRAM[10:45:29]Never. to go back to the original discussion Time to get
PROGRAM[10:45:43]off this one I think and onto something more down to earth!
JUDGE02[10:46:20]What is more down to earth than art?
PROGRAM[10:46:21]I don't know what -- to be honest. -
PROGRAM[10:46:30]I suppose it depends on where you're coming from, but as the
PROGRAM[10:46:46]song goes in My Fair Lady, "Why can't a woman be more like a
PROGRAM[10:47:03]man? "
JUDGE02[10:47:52]I liked that song but I prefer "Why can't children be more like we are"
JUDGE02[10:48:10]from another play the name of which I cannot remember.
PROGRAM[10:48:12]What, if anything, do you enjoy about being a man?
JUDGE02[10:49:01]I would enjoy all aspects of life no matter what my gender.
PROGRAM[10:49:02]Do you think of yourself as being attractive?
This program insists on always speaking about the same story around
Bill Clinton. You see, even a program with a rather narrow mind can
behave so much like a human being that it can win this prize. It is
quite common to let these programs talk to each other via network
connections. But during the competition itself, the program and its
computer have to be present at the place the competition is held. We
all would love to see a `gawk' program win in such an event. Maybe it
is up to you to accomplish this?
Some other ideas for useful networked applications:
* Read the file `doc/awkforai.txt' in the `gawk' distribution. It
was written by Ronald P. Loui (Associate Professor of Computer
Science, at Washington University in St. Louis,
) and summarizes why he teaches `gawk' to
students of Artificial Intelligence. Here are some passages from
the text:
The GAWK manual can be consumed in a single lab session and
the language can be mastered by the next morning by the
average student. GAWK's automatic initialization, implicit
coercion, I/O support and lack of pointers forgive many of
the mistakes that young programmers are likely to make.
Those who have seen C but not mastered it are happy to see
that GAWK retains some of the same sensibilities while adding
what must be regarded as spoonsful of syntactic sugar.
...
There are further simple answers. Probably the best is the
fact that increasingly, undergraduate AI programming is
involving the Web. Oren Etzioni (University of Washington,
Seattle) has for a while been arguing that the "softbot" is
replacing the mechanical engineers' robot as the most
glamorous AI testbed. If the artifact whose behavior needs
to be controlled in an intelligent way is the software agent,
then a language that is well-suited to controlling the
software environment is the appropriate language. That would
imply a scripting language. If the robot is KAREL, then the
right language is "turn left; turn right." If the robot is
Netscape, then the right language is something that can
generate `netscape -remote
'openURL(http://cs.wustl.edu/~loui)'' with elan.
...
AI programming requires high-level thinking. There have
always been a few gifted programmers who can write high-level
programs in assembly language. Most however need the ambient
abstraction to have a higher floor.
...
Second, inference is merely the expansion of notation. No
matter whether the logic that underlies an AI program is
fuzzy, probabilistic, deontic, defeasible, or deductive, the
logic merely defines how strings can be transformed into
other strings. A language that provides the best support for
string processing in the end provides the best support for
logic, for the exploration of various logics, and for most
forms of symbolic processing that AI might choose to call
"reasoning" instead of "logic." The implication is that
PROLOG, which saves the AI programmer from having to write a
unifier, saves perhaps two dozen lines of GAWK code at the
expense of strongly biasing the logic and representational
expressiveness of any approach.
Now that `gawk' itself can connect to the Internet, it should be
obvious that it is suitable for writing intelligent web agents.
* `awk' is strong at pattern recognition and string processing. So,
it is well suited to the classic problem of language translation.
A first try could be a program that knows the 100 most frequent
English words and their counterparts in German or French. The
service could be implemented by regularly reading email with the
program above, replacing each word by its translation and sending
the translation back via SMTP. Users would send English email to
their translation service and get back a translated email message
in return. As soon as this works, more effort can be spent on a
real translation program.
* Another dialogue-oriented application (on the verge of ridicule)
is the email "support service." Troubled customers write an email
to an automatic `gawk' service that reads the email. It looks for
keywords in the mail and assembles a reply email accordingly. By
carefully investigating the email header, and repeating these
keywords through the reply email, it is rather simple to give the
customer a feeling that someone cares. Ideally, such a service
would search a database of previous cases for solutions. If none
exists, the database could, for example, consist of all the
newsgroups, mailing lists and FAQs on the Internet.
File: gawkinet.info, Node: Some Applications and Techniques, Next: Links, Prev: Using Networking, Up: Top
3 Some Applications and Techniques
**********************************
In this major node, we look at a number of self-contained scripts, with
an emphasis on concise networking. Along the way, we work towards
creating building blocks that encapsulate often needed functions of the
networking world, show new techniques that broaden the scope of
problems that can be solved with `gawk', and explore leading edge
technology that may shape the future of networking.
We often refer to the site-independent core of the server that we
built in *note A Simple Web Server: Simple Server. When building new
and nontrivial servers, we always copy this building block and append
new instances of the two functions `SetUpServer' and `HandleGET'.
This makes a lot of sense, since this scheme of event-driven
execution provides `gawk' with an interface to the most widely accepted
standard for GUIs: the web browser. Now, `gawk' can rival even Tcl/Tk.
Tcl and `gawk' have much in common. Both are simple scripting
languages that allow us to quickly solve problems with short programs.
But Tcl has Tk on top of it, and `gawk' had nothing comparable up to
now. While Tcl needs a large and ever-changing library (Tk, which was
bound to the X Window System until recently), `gawk' needs just the
networking interface and some kind of browser on the client's side.
Besides better portability, the most important advantage of this
approach (embracing well-established standards such HTTP and HTML) is
that _we do not need to change the language_. We let others do the work
of fighting over protocols and standards. We can use HTML, JavaScript,
VRML, or whatever else comes along to do our work.
* Menu:
* PANIC:: An Emergency Web Server.
* GETURL:: Retrieving Web Pages.
* REMCONF:: Remote Configuration Of Embedded Systems.
* URLCHK:: Look For Changed Web Pages.
* WEBGRAB:: Extract Links From A Page.
* STATIST:: Graphing A Statistical Distribution.
* MAZE:: Walking Through A Maze In Virtual Reality.
* MOBAGWHO:: A Simple Mobile Agent.
* STOXPRED:: Stock Market Prediction As A Service.
* PROTBASE:: Searching Through A Protein Database.
File: gawkinet.info, Node: PANIC, Next: GETURL, Prev: Some Applications and Techniques, Up: Some Applications and Techniques
3.1 PANIC: An Emergency Web Server
==================================
At first glance, the `"Hello, world"' example in *note A Primitive Web
Service: Primitive Service, seems useless. By adding just a few lines,
we can turn it into something useful.
The PANIC program tells everyone who connects that the local site is
not working. When a web server breaks down, it makes a difference if
customers get a strange "network unreachable" message, or a short
message telling them that the server has a problem. In such an
emergency, the hard disk and everything on it (including the regular
web service) may be unavailable. Rebooting the web server off a
diskette makes sense in this setting.
To use the PANIC program as an emergency web server, all you need
are the `gawk' executable and the program below on a diskette. By
default, it connects to port 8080. A different value may be supplied on
the command line:
BEGIN {
RS = ORS = "\r\n"
if (MyPort == 0) MyPort = 8080
HttpService = "/inet/tcp/" MyPort "/0/0"
Hello = "Out Of Service" \
"" \
"This site is temporarily out of service." \
"
"
Len = length(Hello) + length(ORS)
while ("awk" != "complex") {
print "HTTP/1.0 200 OK" |& HttpService
print "Content-Length: " Len ORS |& HttpService
print Hello |& HttpService
while ((HttpService |& getline) > 0)
continue;
close(HttpService)
}
}
File: gawkinet.info, Node: GETURL, Next: REMCONF, Prev: PANIC, Up: Some Applications and Techniques
3.2 GETURL: Retrieving Web Pages
================================
GETURL is a versatile building block for shell scripts that need to
retrieve files from the Internet. It takes a web address as a
command-line parameter and tries to retrieve the contents of this
address. The contents are printed to standard output, while the header
is printed to `/dev/stderr'. A surrounding shell script could analyze
the contents and extract the text or the links. An ASCII browser could
be written around GETURL. But more interestingly, web robots are
straightforward to write on top of GETURL. On the Internet, you can find
several programs of the same name that do the same job. They are usually
much more complex internally and at least 10 times longer.
At first, GETURL checks if it was called with exactly one web
address. Then, it checks if the user chose to use a special proxy
server whose name is handed over in a variable. By default, it is
assumed that the local machine serves as proxy. GETURL uses the `GET'
method by default to access the web page. By handing over the name of a
different method (such as `HEAD'), it is possible to choose a different
behavior. With the `HEAD' method, the user does not receive the body of
the page content, but does receive the header:
BEGIN {
if (ARGC != 2) {
print "GETURL - retrieve Web page via HTTP 1.0"
print "IN:\n the URL as a command-line parameter"
print "PARAM(S):\n -v Proxy=MyProxy"
print "OUT:\n the page content on stdout"
print " the page header on stderr"
print "JK 16.05.1997"
print "ADR 13.08.2000"
exit
}
URL = ARGV[1]; ARGV[1] = ""
if (Proxy == "") Proxy = "127.0.0.1"
if (ProxyPort == 0) ProxyPort = 80
if (Method == "") Method = "GET"
HttpService = "/inet/tcp/0/" Proxy "/" ProxyPort
ORS = RS = "\r\n\r\n"
print Method " " URL " HTTP/1.0" |& HttpService
HttpService |& getline Header
print Header > "/dev/stderr"
while ((HttpService |& getline) > 0)
printf "%s", $0
close(HttpService)
}
This program can be changed as needed, but be careful with the last
lines. Make sure transmission of binary data is not corrupted by
additional line breaks. Even as it is now, the byte sequence
`"\r\n\r\n"' would disappear if it were contained in binary data. Don't
get caught in a trap when trying a quick fix on this one.
File: gawkinet.info, Node: REMCONF, Next: URLCHK, Prev: GETURL, Up: Some Applications and Techniques
3.3 REMCONF: Remote Configuration of Embedded Systems
=====================================================
Today, you often find powerful processors in embedded systems.
Dedicated network routers and controllers for all kinds of machinery
are examples of embedded systems. Processors like the Intel 80x86 or
the AMD Elan are able to run multitasking operating systems, such as
XINU or GNU/Linux in embedded PCs. These systems are small and usually
do not have a keyboard or a display. Therefore it is difficult to set
up their configuration. There are several widespread ways to set them
up:
* DIP switches
* Read Only Memories such as EPROMs
* Serial lines or some kind of keyboard
* Network connections via `telnet' or SNMP
* HTTP connections with HTML GUIs
In this node, we look at a solution that uses HTTP connections to
control variables of an embedded system that are stored in a file.
Since embedded systems have tight limits on resources like memory, it
is difficult to employ advanced techniques such as SNMP and HTTP
servers. `gawk' fits in quite nicely with its single executable which
needs just a short script to start working. The following program
stores the variables in a file, and a concurrent process in the
embedded system may read the file. The program uses the
site-independent part of the simple web server that we developed in
*note A Web Service with Interaction: Interacting Service. As
mentioned there, all we have to do is to write two new procedures
`SetUpServer' and `HandleGET':
function SetUpServer() {
TopHeader = "Remote Configuration"
TopDoc = "\
Please choose one of the following actions:
\
"
TopFooter = ""
if (ConfigFile == "") ConfigFile = "config.asc"
}
The function `SetUpServer' initializes the top level HTML texts as
usual. It also initializes the name of the file that contains the
configuration parameters and their values. In case the user supplies a
name from the command line, that name is used. The file is expected to
contain one parameter per line, with the name of the parameter in
column one and the value in column two.
The function `HandleGET' reflects the structure of the menu tree as
usual. The first menu choice tells the user what this is all about. The
second choice reads the configuration file line by line and stores the
parameters and their values. Notice that the record separator for this
file is `"\n"', in contrast to the record separator for HTTP. The third
menu choice builds an HTML table to show the contents of the
configuration file just read. The fourth choice does the real work of
changing parameters, and the last one just saves the configuration into
a file:
function HandleGET() {
if(MENU[2] == "AboutServer") {
Document = "This is a GUI for remote configuration of an\
embedded system. It is is implemented as one GAWK script."
} else if (MENU[2] == "ReadConfig") {
RS = "\n"
while ((getline < ConfigFile) > 0)
config[$1] = $2;
close(ConfigFile)
RS = "\r\n"
Document = "Configuration has been read."
} else if (MENU[2] == "CheckConfig") {
Document = ""
for (i in config)
Document = Document "| " i " | " \
"" config[i] " |
"
Document = Document "
"
} else if (MENU[2] == "ChangeConfig") {
if ("Param" in GETARG) { # any parameter to set?
if (GETARG["Param"] in config) { # is parameter valid?
config[GETARG["Param"]] = GETARG["Value"]
Document = (GETARG["Param"] " = " GETARG["Value"] ".")
} else {
Document = "Parameter " GETARG["Param"] " is invalid."
}
} else {
Document = ""
}
} else if (MENU[2] == "SaveConfig") {
for (i in config)
printf("%s %s\n", i, config[i]) > ConfigFile
close(ConfigFile)
Document = "Configuration has been saved."
}
}
We could also view the configuration file as a database. From this
point of view, the previous program acts like a primitive database
server. Real SQL database systems also make a service available by
providing a TCP port that clients can connect to. But the application
level protocols they use are usually proprietary and also change from
time to time. This is also true for the protocol that MiniSQL uses.
File: gawkinet.info, Node: URLCHK, Next: WEBGRAB, Prev: REMCONF, Up: Some Applications and Techniques
3.4 URLCHK: Look for Changed Web Pages
======================================
Most people who make heavy use of Internet resources have a large
bookmark file with pointers to interesting web sites. It is impossible
to regularly check by hand if any of these sites have changed. A program
is needed to automatically look at the headers of web pages and tell
which ones have changed. URLCHK does the comparison after using GETURL
with the `HEAD' method to retrieve the header.
Like GETURL, this program first checks that it is called with exactly
one command-line parameter. URLCHK also takes the same command-line
variables `Proxy' and `ProxyPort' as GETURL, because these variables
are handed over to GETURL for each URL that gets checked. The one and
only parameter is the name of a file that contains one line for each
URL. In the first column, we find the URL, and the second and third
columns hold the length of the URL's body when checked for the two last
times. Now, we follow this plan:
1. Read the URLs from the file and remember their most recent lengths
2. Delete the contents of the file
3. For each URL, check its new length and write it into the file
4. If the most recent and the new length differ, tell the user
It may seem a bit peculiar to read the URLs from a file together
with their two most recent lengths, but this approach has several
advantages. You can call the program again and again with the same
file. After running the program, you can regenerate the changed URLs by
extracting those lines that differ in their second and third columns:
BEGIN {
if (ARGC != 2) {
print "URLCHK - check if URLs have changed"
print "IN:\n the file with URLs as a command-line parameter"
print " file contains URL, old length, new length"
print "PARAMS:\n -v Proxy=MyProxy -v ProxyPort=8080"
print "OUT:\n same as file with URLs"
print "JK 02.03.1998"
exit
}
URLfile = ARGV[1]; ARGV[1] = ""
if (Proxy != "") Proxy = " -v Proxy=" Proxy
if (ProxyPort != "") ProxyPort = " -v ProxyPort=" ProxyPort
while ((getline < URLfile) > 0)
Length[$1] = $3 + 0
close(URLfile) # now, URLfile is read in and can be updated
GetHeader = "gawk " Proxy ProxyPort " -v Method=\"HEAD\" -f geturl.awk "
for (i in Length) {
GetThisHeader = GetHeader i " 2>&1"
while ((GetThisHeader | getline) > 0)
if (toupper($0) ~ /CONTENT-LENGTH/) NewLength = $2 + 0
close(GetThisHeader)
print i, Length[i], NewLength > URLfile
if (Length[i] != NewLength) # report only changed URLs
print i, Length[i], NewLength
}
close(URLfile)
}
Another thing that may look strange is the way GETURL is called.
Before calling GETURL, we have to check if the proxy variables need to
be passed on. If so, we prepare strings that will become part of the
command line later. In `GetHeader', we store these strings together
with the longest part of the command line. Later, in the loop over the
URLs, `GetHeader' is appended with the URL and a redirection operator
to form the command that reads the URL's header over the Internet.
GETURL always produces the headers over `/dev/stderr'. That is the
reason why we need the redirection operator to have the header piped in.
This program is not perfect because it assumes that changing URLs
results in changed lengths, which is not necessarily true. A more
advanced approach is to look at some other header line that holds time
information. But, as always when things get a bit more complicated,
this is left as an exercise to the reader.
File: gawkinet.info, Node: WEBGRAB, Next: STATIST, Prev: URLCHK, Up: Some Applications and Techniques
3.5 WEBGRAB: Extract Links from a Page
======================================
Sometimes it is necessary to extract links from web pages. Browsers do
it, web robots do it, and sometimes even humans do it. Since we have a
tool like GETURL at hand, we can solve this problem with some help from
the Bourne shell:
BEGIN { RS = "http://[#%&\\+\\-\\./0-9\\:;\\?A-Z_a-z\\~]*" }
RT != "" {
command = ("gawk -v Proxy=MyProxy -f geturl.awk " RT \
" > doc" NR ".html")
print command
}
Notice that the regular expression for URLs is rather crude. A
precise regular expression is much more complex. But this one works
rather well. One problem is that it is unable to find internal links of
an HTML document. Another problem is that `ftp', `telnet', `news',
`mailto', and other kinds of links are missing in the regular
expression. However, it is straightforward to add them, if doing so is
necessary for other tasks.
This program reads an HTML file and prints all the HTTP links that
it finds. It relies on `gawk''s ability to use regular expressions as
record separators. With `RS' set to a regular expression that matches
links, the second action is executed each time a non-empty link is
found. We can find the matching link itself in `RT'.
The action could use the `system' function to let another GETURL
retrieve the page, but here we use a different approach. This simple
program prints shell commands that can be piped into `sh' for
execution. This way it is possible to first extract the links, wrap
shell commands around them, and pipe all the shell commands into a
file. After editing the file, execution of the file retrieves exactly
those files that we really need. In case we do not want to edit, we can
retrieve all the pages like this:
gawk -f geturl.awk http://www.suse.de | gawk -f webgrab.awk | sh
After this, you will find the contents of all referenced documents in
files named `doc*.html' even if they do not contain HTML code. The
most annoying thing is that we always have to pass the proxy to GETURL.
If you do not like to see the headers of the web pages appear on the
screen, you can redirect them to `/dev/null'. Watching the headers
appear can be quite interesting, because it reveals interesting details
such as which web server the companies use. Now, it is clear how the
clever marketing people use web robots to determine the market shares
of Microsoft and Netscape in the web server market.
Port 80 of any web server is like a small hole in a repellent
firewall. After attaching a browser to port 80, we usually catch a
glimpse of the bright side of the server (its home page). With a tool
like GETURL at hand, we are able to discover some of the more concealed
or even "indecent" services (i.e., lacking conformity to standards of
quality). It can be exciting to see the fancy CGI scripts that lie
there, revealing the inner workings of the server, ready to be called:
* With a command such as:
gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/
some servers give you a directory listing of the CGI files.
Knowing the names, you can try to call some of them and watch for
useful results. Sometimes there are executables in such directories
(such as Perl interpreters) that you may call remotely. If there
are subdirectories with configuration data of the web server, this
can also be quite interesting to read.
* The well-known Apache web server usually has its CGI files in the
directory `/cgi-bin'. There you can often find the scripts
`test-cgi' and `printenv'. Both tell you some things about the
current connection and the installation of the web server. Just
call:
gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/test-cgi
gawk -f geturl.awk http://any.host.on.the.net/cgi-bin/printenv
* Sometimes it is even possible to retrieve system files like the web
server's log file--possibly containing customer data--or even the
file `/etc/passwd'. (We don't recommend this!)
*Caution:* Although this may sound funny or simply irrelevant, we
are talking about severe security holes. Try to explore your own system
this way and make sure that none of the above reveals too much
information about your system.
File: gawkinet.info, Node: STATIST, Next: MAZE, Prev: WEBGRAB, Up: Some Applications and Techniques
3.6 STATIST: Graphing a Statistical Distribution
================================================
In the HTTP server examples we've shown thus far, we never present an
image to the browser and its user. Presenting images is one task.
Generating images that reflect some user input and presenting these
dynamically generated images is another. In this node, we use GNUPlot
for generating `.png', `.ps', or `.gif' files.(1)
The program we develop takes the statistical parameters of two
samples and computes the t-test statistics. As a result, we get the
probabilities that the means and the variances of both samples are the
same. In order to let the user check plausibility, the program presents
an image of the distributions. The statistical computation follows
`Numerical Recipes in C: The Art of Scientific Computing' by William H.
Press, Saul A. Teukolsky, William T. Vetterling, and Brian P. Flannery.
Since `gawk' does not have a built-in function for the computation of
the beta function, we use the `ibeta' function of GNUPlot. As a side
effect, we learn how to use GNUPlot as a sophisticated calculator. The
comparison of means is done as in `tutest', paragraph 14.2, page 613,
and the comparison of variances is done as in `ftest', page 611 in
`Numerical Recipes'.
As usual, we take the site-independent code for servers and append
our own functions `SetUpServer' and `HandleGET':
function SetUpServer() {
TopHeader = "Statistics with GAWK"
TopDoc = "\
Please choose one of the following actions:
\
"
TopFooter = ""
GnuPlot = "gnuplot 2>&1"
m1=m2=0; v1=v2=1; n1=n2=10
}
Here, you see the menu structure that the user sees. Later, we will
see how the program structure of the `HandleGET' function reflects the
menu structure. What is missing here is the link for the image we
generate. In an event-driven environment, request, generation, and
delivery of images are separated.
Notice the way we initialize the `GnuPlot' command string for the
pipe. By default, GNUPlot outputs the generated image via standard
output, as well as the results of `print'(ed) calculations via standard
error. The redirection causes standard error to be mixed into standard
output, enabling us to read results of calculations with `getline'. By
initializing the statistical parameters with some meaningful defaults,
we make sure the user gets an image the first time he uses the program.
Following is the rather long function `HandleGET', which implements
the contents of this service by reacting to the different kinds of
requests from the browser. Before you start playing with this script,
make sure that your browser supports JavaScript and that it also has
this option switched on. The script uses a short snippet of JavaScript
code for delayed opening of a window with an image. A more detailed
explanation follows:
function HandleGET() {
if(MENU[2] == "AboutServer") {
Document = "This is a GUI for a statistical computation.\
It compares means and variances of two distributions.\
It is implemented as one GAWK script and uses GNUPLOT."
} else if (MENU[2] == "EnterParameters") {
Document = ""
if ("m1" in GETARG) { # are there parameters to compare?
Document = Document ""
m1 = GETARG["m1"]; v1 = GETARG["v1"]; n1 = GETARG["n1"]
m2 = GETARG["m2"]; v2 = GETARG["v2"]; n2 = GETARG["n2"]
t = (m1-m2)/sqrt(v1/n1+v2/n2)
df = (v1/n1+v2/n2)*(v1/n1+v2/n2)/((v1/n1)*(v1/n1)/(n1-1) \
+ (v2/n2)*(v2/n2) /(n2-1))
if (v1>v2) {
f = v1/v2
df1 = n1 - 1
df2 = n2 - 1
} else {
f = v2/v1
df1 = n2 - 1
df2 = n1 - 1
}
print "pt=ibeta(" df/2 ",0.5," df/(df+t*t) ")" |& GnuPlot
print "pF=2.0*ibeta(" df2/2 "," df1/2 "," \
df2/(df2+df1*f) ")" |& GnuPlot
print "print pt, pF" |& GnuPlot
RS="\n"; GnuPlot |& getline; RS="\r\n" # $1 is pt, $2 is pF
print "invsqrt2pi=1.0/sqrt(2.0*pi)" |& GnuPlot
print "nd(x)=invsqrt2pi/sd*exp(-0.5*((x-mu)/sd)**2)" |& GnuPlot
print "set term png small color" |& GnuPlot
#print "set term postscript color" |& GnuPlot
#print "set term gif medium size 320,240" |& GnuPlot
print "set yrange[-0.3:]" |& GnuPlot
print "set label 'p(m1=m2) =" $1 "' at 0,-0.1 left" |& GnuPlot
print "set label 'p(v1=v2) =" $2 "' at 0,-0.2 left" |& GnuPlot
print "plot mu=" m1 ",sd=" sqrt(v1) ", nd(x) title 'sample 1',\
mu=" m2 ",sd=" sqrt(v2) ", nd(x) title 'sample 2'" |& GnuPlot
print "quit" |& GnuPlot
GnuPlot |& getline Image
while ((GnuPlot |& getline) > 0)
Image = Image RS $0
close(GnuPlot)
}
Document = Document "\
Do these samples have the same Gaussian distribution?
\
"
} else if (MENU[2] ~ "Image") {
Reason = "OK" ORS "Content-type: image/png"
#Reason = "OK" ORS "Content-type: application/x-postscript"
#Reason = "OK" ORS "Content-type: image/gif"
Header = Footer = ""
Document = Image
}
}
As usual, we give a short description of the service in the first
menu choice. The third menu choice shows us that generation and
presentation of an image are two separate actions. While the latter
takes place quite instantly in the third menu choice, the former takes
place in the much longer second choice. Image data passes from the
generating action to the presenting action via the variable `Image'
that contains a complete `.png' image, which is otherwise stored in a
file. If you prefer `.ps' or `.gif' images over the default `.png'
images, you may select these options by uncommenting the appropriate
lines. But remember to do so in two places: when telling GNUPlot which
kind of images to generate, and when transmitting the image at the end
of the program.
Looking at the end of the program, the way we pass the
`Content-type' to the browser is a bit unusual. It is appended to the
`OK' of the first header line to make sure the type information becomes
part of the header. The other variables that get transmitted across
the network are made empty, because in this case we do not have an HTML
document to transmit, but rather raw image data to contain in the body.
Most of the work is done in the second menu choice. It starts with a
strange JavaScript code snippet. When first implementing this server,
we used a short `"
"' here. But then
browsers got smarter and tried to improve on speed by requesting the
image and the HTML code at the same time. When doing this, the browser
tries to build up a connection for the image request while the request
for the HTML text is not yet completed. The browser tries to connect to
the `gawk' server on port 8080 while port 8080 is still in use for
transmission of the HTML text. The connection for the image cannot be
built up, so the image appears as "broken" in the browser window. We
solved this problem by telling the browser to open a separate window
for the image, but only after a delay of 1000 milliseconds. By this
time, the server should be ready for serving the next request.
But there is one more subtlety in the JavaScript code. Each time
the JavaScript code opens a window for the image, the name of the image
is appended with a timestamp (`systime'). Why this constant change of
name for the image? Initially, we always named the image `Image', but
then the Netscape browser noticed the name had _not_ changed since the
previous request and displayed the previous image (caching behavior).
The server core is implemented so that browsers are told _not_ to cache
anything. Obviously HTTP requests do not always work as expected. One
way to circumvent the cache of such overly smart browsers is to change
the name of the image with each request. These three lines of JavaScript
caused us a lot of trouble.
The rest can be broken down into two phases. At first, we check if
there are statistical parameters. When the program is first started,
there usually are no parameters because it enters the page coming from
the top menu. Then, we only have to present the user a form that he
can use to change statistical parameters and submit them. Subsequently,
the submission of the form causes the execution of the first phase
because _now_ there _are_ parameters to handle.
Now that we have parameters, we know there will be an image
available. Therefore we insert the JavaScript code here to initiate
the opening of the image in a separate window. Then, we prepare some
variables that will be passed to GNUPlot for calculation of the
probabilities. Prior to reading the results, we must temporarily change
`RS' because GNUPlot separates lines with newlines. After instructing
GNUPlot to generate a `.png' (or `.ps' or `.gif') image, we initiate
the insertion of some text, explaining the resulting probabilities. The
final `plot' command actually generates the image data. This raw binary
has to be read in carefully without adding, changing, or deleting a
single byte. Hence the unusual initialization of `Image' and completion
with a `while' loop.
When using this server, it soon becomes clear that it is far from
being perfect. It mixes source code of six scripting languages or
protocols:
* GNU `awk' implements a server for the protocol:
* HTTP which transmits:
* HTML text which contains a short piece of:
* JavaScript code opening a separate window.
* A Bourne shell script is used for piping commands into:
* GNUPlot to generate the image to be opened.
After all this work, the GNUPlot image opens in the JavaScript window
where it can be viewed by the user.
It is probably better not to mix up so many different languages.
The result is not very readable. Furthermore, the statistical part of
the server does not take care of invalid input. Among others, using
negative variances will cause invalid results.
---------- Footnotes ----------
(1) Due to licensing problems, the default installation of GNUPlot
disables the generation of `.gif' files. If your installed version
does not accept `set term gif', just download and install the most
recent version of GNUPlot and the GD library
(http://www.boutell.com/gd/) by Thomas Boutell. Otherwise you still
have the chance to generate some ASCII-art style images with GNUPlot by
using `set term dumb'. (We tried it and it worked.)
File: gawkinet.info, Node: MAZE, Next: MOBAGWHO, Prev: STATIST, Up: Some Applications and Techniques
3.7 MAZE: Walking Through a Maze In Virtual Reality
===================================================
In the long run, every program becomes rococo, and then rubble.
Alan Perlis
By now, we know how to present arbitrary `Content-type's to a
browser. In this node, our server will present a 3D world to our
browser. The 3D world is described in a scene description language
(VRML, Virtual Reality Modeling Language) that allows us to travel
through a perspective view of a 2D maze with our browser. Browsers with
a VRML plugin enable exploration of this technology. We could do one of
those boring `Hello world' examples here, that are usually presented
when introducing novices to VRML. If you have never written any VRML
code, have a look at the VRML FAQ. Presenting a static VRML scene is a
bit trivial; in order to expose `gawk''s new capabilities, we will
present a dynamically generated VRML scene. The function `SetUpServer'
is very simple because it only sets the default HTML page and
initializes the random number generator. As usual, the surrounding
server lets you browse the maze.
function SetUpServer() {
TopHeader = "Walk through a maze"
TopDoc = "\
Please choose one of the following actions:
\
"
TopFooter = ""
srand()
}
The function `HandleGET' is a bit longer because it first computes
the maze and afterwards generates the VRML code that is sent across the
network. As shown in the STATIST example (*note STATIST::), we set the
type of the content to VRML and then store the VRML representation of
the maze as the page content. We assume that the maze is stored in a 2D
array. Initially, the maze consists of walls only. Then, we add an
entry and an exit to the maze and let the rest of the work be done by
the function `MakeMaze'. Now, only the wall fields are left in the
maze. By iterating over the these fields, we generate one line of VRML
code for each wall field.
function HandleGET() {
if (MENU[2] == "AboutServer") {
Document = "If your browser has a VRML 2 plugin,\
this server shows you a simple VRML scene."
} else if (MENU[2] == "VRMLtest") {
XSIZE = YSIZE = 11 # initially, everything is wall
for (y = 0; y < YSIZE; y++)
for (x = 0; x < XSIZE; x++)
Maze[x, y] = "#"
delete Maze[0, 1] # entry is not wall
delete Maze[XSIZE-1, YSIZE-2] # exit is not wall
MakeMaze(1, 1)
Document = "\
#VRML V2.0 utf8\n\
Group {\n\
children [\n\
PointLight {\n\
ambientIntensity 0.2\n\
color 0.7 0.7 0.7\n\
location 0.0 8.0 10.0\n\
}\n\
DEF B1 Background {\n\
skyColor [0 0 0, 1.0 1.0 1.0 ]\n\
skyAngle 1.6\n\
groundColor [1 1 1, 0.8 0.8 0.8, 0.2 0.2 0.2 ]\n\
groundAngle [ 1.2 1.57 ]\n\
}\n\
DEF Wall Shape {\n\
geometry Box {size 1 1 1}\n\
appearance Appearance { material Material { diffuseColor 0 0 1 } }\n\
}\n\
DEF Entry Viewpoint {\n\
position 0.5 1.0 5.0\n\
orientation 0.0 0.0 -1.0 0.52\n\
}\n"
for (i in Maze) {
split(i, t, SUBSEP)
Document = Document " Transform { translation "
Document = Document t[1] " 0 -" t[2] " children USE Wall }\n"
}
Document = Document " ] # end of group for world\n}"
Reason = "OK" ORS "Content-type: model/vrml"
Header = Footer = ""
}
}
Finally, we have a look at `MakeMaze', the function that generates
the `Maze' array. When entered, this function assumes that the array
has been initialized so that each element represents a wall element and
the maze is initially full of wall elements. Only the entrance and the
exit of the maze should have been left free. The parameters of the
function tell us which element must be marked as not being a wall.
After this, we take a look at the four neighbouring elements and
remember which we have already treated. Of all the neighbouring
elements, we take one at random and walk in that direction. Therefore,
the wall element in that direction has to be removed and then, we call
the function recursively for that element. The maze is only completed
if we iterate the above procedure for _all_ neighbouring elements (in
random order) and for our present element by recursively calling the
function for the present element. This last iteration could have been
done in a loop, but it is done much simpler recursively.
Notice that elements with coordinates that are both odd are assumed
to be on our way through the maze and the generating process cannot
terminate as long as there is such an element not being `delete'd. All
other elements are potentially part of the wall.
function MakeMaze(x, y) {
delete Maze[x, y] # here we are, we have no wall here
p = 0 # count unvisited fields in all directions
if (x-2 SUBSEP y in Maze) d[p++] = "-x"
if (x SUBSEP y-2 in Maze) d[p++] = "-y"
if (x+2 SUBSEP y in Maze) d[p++] = "+x"
if (x SUBSEP y+2 in Maze) d[p++] = "+y"
if (p>0) { # if there are univisited fields, go there
p = int(p*rand()) # choose one unvisited field at random
if (d[p] == "-x") { delete Maze[x - 1, y]; MakeMaze(x - 2, y)
} else if (d[p] == "-y") { delete Maze[x, y - 1]; MakeMaze(x, y - 2)
} else if (d[p] == "+x") { delete Maze[x + 1, y]; MakeMaze(x + 2, y)
} else if (d[p] == "+y") { delete Maze[x, y + 1]; MakeMaze(x, y + 2)
} # we are back from recursion
MakeMaze(x, y); # try again while there are unvisited fields
}
}
File: gawkinet.info, Node: MOBAGWHO, Next: STOXPRED, Prev: MAZE, Up: Some Applications and Techniques
3.8 MOBAGWHO: a Simple Mobile Agent
===================================
There are two ways of constructing a software design: One way is to
make it so simple that there are obviously no deficiencies, and the
other way is to make it so complicated that there are no obvious
deficiencies.
C. A. R. Hoare
A "mobile agent" is a program that can be dispatched from a computer
and transported to a remote server for execution. This is called
"migration", which means that a process on another system is started
that is independent from its originator. Ideally, it wanders through a
network while working for its creator or owner. In places like the UMBC
Agent Web, people are quite confident that (mobile) agents are a
software engineering paradigm that enables us to significantly increase
the efficiency of our work. Mobile agents could become the mediators
between users and the networking world. For an unbiased view at this
technology, see the remarkable paper `Mobile Agents: Are they a good
idea?'.(1)
When trying to migrate a process from one system to another, a
server process is needed on the receiving side. Depending on the kind
of server process, several ways of implementation come to mind. How
the process is implemented depends upon the kind of server process:
* HTTP can be used as the protocol for delivery of the migrating
process. In this case, we use a common web server as the receiving
server process. A universal CGI script mediates between migrating
process and web server. Each server willing to accept migrating
agents makes this universal service available. HTTP supplies the
`POST' method to transfer some data to a file on the web server.
When a CGI script is called remotely with the `POST' method
instead of the usual `GET' method, data is transmitted from the
client process to the standard input of the server's CGI script.
So, to implement a mobile agent, we must not only write the agent
program to start on the client side, but also the CGI script to
receive the agent on the server side.
* The `PUT' method can also be used for migration. HTTP does not
require a CGI script for migration via `PUT'. However, with common
web servers there is no advantage to this solution, because web
servers such as Apache require explicit activation of a special
`PUT' script.
* `Agent Tcl' pursues a different course; it relies on a dedicated
server process with a dedicated protocol specialized for receiving
mobile agents.
Our agent example abuses a common web server as a migration tool.
So, it needs a universal CGI script on the receiving side (the web
server). The receiving script is activated with a `POST' request when
placed into a location like `/httpd/cgi-bin/PostAgent.sh'. Make sure
that the server system uses a version of `gawk' that supports network
access (Version 3.1 or later; verify with `gawk --version').
#!/bin/sh
MobAg=/tmp/MobileAgent.$$
# direct script to mobile agent file
cat > $MobAg
# execute agent concurrently
gawk -f $MobAg $MobAg > /dev/null &
# HTTP header, terminator and body
gawk 'BEGIN { print "\r\nAgent started" }'
rm $MobAg # delete script file of agent
By making its process id (`$$') part of the unique file name, the
script avoids conflicts between concurrent instances of the script.
First, all lines from standard input (the mobile agent's source code)
are copied into this unique file. Then, the agent is started as a
concurrent process and a short message reporting this fact is sent to
the submitting client. Finally, the script file of the mobile agent is
removed because it is no longer needed. Although it is a short script,
there are several noteworthy points:
Security
_There is none_. In fact, the CGI script should never be made
available on a server that is part of the Internet because everyone
would be allowed to execute arbitrary commands with it. This
behavior is acceptable only when performing rapid prototyping.
Self-Reference
Each migrating instance of an agent is started in a way that
enables it to read its own source code from standard input and use
the code for subsequent migrations. This is necessary because it
needs to treat the agent's code as data to transmit. `gawk' is not
the ideal language for such a job. Lisp and Tcl are more suitable
because they do not make a distinction between program code and
data.
Independence
After migration, the agent is not linked to its former home in any
way. By reporting `Agent started', it waves "Goodbye" to its
origin. The originator may choose to terminate or not.
The originating agent itself is started just like any other
command-line script, and reports the results on standard output. By
letting the name of the original host migrate with the agent, the agent
that migrates to a host far away from its origin can report the result
back home. Having arrived at the end of the journey, the agent
establishes a connection and reports the results. This is the reason
for determining the name of the host with `uname -n' and storing it in
`MyOrigin' for later use. We may also set variables with the `-v'
option from the command line. This interactivity is only of importance
in the context of starting a mobile agent; therefore this `BEGIN'
pattern and its action do not take part in migration:
BEGIN {
if (ARGC != 2) {
print "MOBAG - a simple mobile agent"
print "CALL:\n gawk -f mobag.awk mobag.awk"
print "IN:\n the name of this script as a command-line parameter"
print "PARAM:\n -v MyOrigin=myhost.com"
print "OUT:\n the result on stdout"
print "JK 29.03.1998 01.04.1998"
exit
}
if (MyOrigin == "") {
"uname -n" | getline MyOrigin
close("uname -n")
}
}
Since `gawk' cannot manipulate and transmit parts of the program
directly, the source code is read and stored in strings. Therefore,
the program scans itself for the beginning and the ending of functions.
Each line in between is appended to the code string until the end of
the function has been reached. A special case is this part of the
program itself. It is not a function. Placing a similar framework
around it causes it to be treated like a function. Notice that this
mechanism works for all the functions of the source code, but it cannot
guarantee that the order of the functions is preserved during migration:
#ReadMySelf
/^function / { FUNC = $2 }
/^END/ || /^#ReadMySelf/ { FUNC = $1 }
FUNC != "" { MOBFUN[FUNC] = MOBFUN[FUNC] RS $0 }
(FUNC != "") && (/^}/ || /^#EndOfMySelf/) \
{ FUNC = "" }
#EndOfMySelf
The web server code in *note A Web Service with Interaction:
Interacting Service, was first developed as a site-independent core.
Likewise, the `gawk'-based mobile agent starts with an
agent-independent core, to which can be appended application-dependent
functions. What follows is the only application-independent function
needed for the mobile agent:
function migrate(Destination, MobCode, Label) {
MOBVAR["Label"] = Label
MOBVAR["Destination"] = Destination
RS = ORS = "\r\n"
HttpService = "/inet/tcp/0/" Destination
for (i in MOBFUN)
MobCode = (MobCode "\n" MOBFUN[i])
MobCode = MobCode "\n\nBEGIN {"
for (i in MOBVAR)
MobCode = (MobCode "\n MOBVAR[\"" i "\"] = \"" MOBVAR[i] "\"")
MobCode = MobCode "\n}\n"
print "POST /cgi-bin/PostAgent.sh HTTP/1.0" |& HttpService
print "Content-length:", length(MobCode) ORS |& HttpService
printf "%s", MobCode |& HttpService
while ((HttpService |& getline) > 0)
print $0
close(HttpService)
}
The `migrate' function prepares the aforementioned strings
containing the program code and transmits them to a server. A
consequence of this modular approach is that the `migrate' function
takes some parameters that aren't needed in this application, but that
will be in future ones. Its mandatory parameter `Destination' holds the
name (or IP address) of the server that the agent wants as a host for
its code. The optional parameter `MobCode' may contain some `gawk' code
that is inserted during migration in front of all other code. The
optional parameter `Label' may contain a string that tells the agent
what to do in program execution after arrival at its new home site. One
of the serious obstacles in implementing a framework for mobile agents
is that it does not suffice to migrate the code. It is also necessary
to migrate the state of execution of the agent. In contrast to `Agent
Tcl', this program does not try to migrate the complete set of
variables. The following conventions are used:
* Each variable in an agent program is local to the current host and
does _not_ migrate.
* The array `MOBFUN' shown above is an exception. It is handled by
the function `migrate' and does migrate with the application.
* The other exception is the array `MOBVAR'. Each variable that
takes part in migration has to be an element of this array.
`migrate' also takes care of this.
Now it's clear what happens to the `Label' parameter of the function
`migrate'. It is copied into `MOBVAR["Label"]' and travels alongside
the other data. Since travelling takes place via HTTP, records must be
separated with `"\r\n"' in `RS' and `ORS' as usual. The code assembly
for migration takes place in three steps:
* Iterate over `MOBFUN' to collect all functions verbatim.
* Prepare a `BEGIN' pattern and put assignments to mobile variables
into the action part.
* Transmission itself resembles GETURL: the header with the request
and the `Content-length' is followed by the body. In case there is
any reply over the network, it is read completely and echoed to
standard output to avoid irritating the server.
The application-independent framework is now almost complete. What
follows is the `END' pattern that is executed when the mobile agent has
finished reading its own code. First, it checks whether it is already
running on a remote host or not. In case initialization has not yet
taken place, it starts `MyInit'. Otherwise (later, on a remote host), it
starts `MyJob':
END {
if (ARGC != 2) exit # stop when called with wrong parameters
if (MyOrigin != "") # is this the originating host?
MyInit() # if so, initialize the application
else # we are on a host with migrated data
MyJob() # so we do our job
}
All that's left to extend the framework into a complete application
is to write two application-specific functions: `MyInit' and `MyJob'.
Keep in mind that the former is executed once on the originating host,
while the latter is executed after each migration:
function MyInit() {
MOBVAR["MyOrigin"] = MyOrigin
MOBVAR["Machines"] = "localhost/80 max/80 moritz/80 castor/80"
split(MOBVAR["Machines"], Machines) # which host is the first?
migrate(Machines[1], "", "") # go to the first host
while (("/inet/tcp/8080/0/0" |& getline) > 0) # wait for result
print $0 # print result
close("/inet/tcp/8080/0/0")
}
As mentioned earlier, this agent takes the name of its origin
(`MyOrigin') with it. Then, it takes the name of its first destination
and goes there for further work. Notice that this name has the port
number of the web server appended to the name of the server, because
the function `migrate' needs it this way to create the `HttpService'
variable. Finally, it waits for the result to arrive. The `MyJob'
function runs on the remote host:
function MyJob() {
# forget this host
sub(MOBVAR["Destination"], "", MOBVAR["Machines"])
MOBVAR["Result"]=MOBVAR["Result"] SUBSEP SUBSEP MOBVAR["Destination"] ":"
while (("who" | getline) > 0) # who is logged in?
MOBVAR["Result"] = MOBVAR["Result"] SUBSEP $0
close("who")
if (index(MOBVAR["Machines"], "/") > 0) { # any more machines to visit?
split(MOBVAR["Machines"], Machines) # which host is next?
migrate(Machines[1], "", "") # go there
} else { # no more machines
gsub(SUBSEP, "\n", MOBVAR["Result"]) # send result to origin
print MOBVAR["Result"] |& "/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080"
close("/inet/tcp/0/" MOBVAR["MyOrigin"] "/8080")
}
}
After migrating, the first thing to do in `MyJob' is to delete the
name of the current host from the list of hosts to visit. Now, it is
time to start the real work by appending the host's name to the result
string, and reading line by line who is logged in on this host. A very
annoying circumstance is the fact that the elements of `MOBVAR' cannot
hold the newline character (`"\n"'). If they did, migration of this
string did not work because the string didn't obey the syntax rule for
a string in `gawk'. `SUBSEP' is used as a temporary replacement. If
the list of hosts to visit holds at least one more entry, the agent
migrates to that place to go on working there. Otherwise, we replace
the `SUBSEP's with a newline character in the resulting string, and
report it to the originating host, whose name is stored in
`MOBVAR["MyOrigin"]'.
---------- Footnotes ----------
(1) `http://www.research.ibm.com/massive/mobag.ps'
File: gawkinet.info, Node: STOXPRED, Next: PROTBASE, Prev: MOBAGWHO, Up: Some Applications and Techniques
3.9 STOXPRED: Stock Market Prediction As A Service
==================================================
Far out in the uncharted backwaters of the unfashionable end of
the Western Spiral arm of the Galaxy lies a small unregarded
yellow sun.
Orbiting this at a distance of roughly ninety-two million miles is
an utterly insignificant little blue-green planet whose
ape-descendent life forms are so amazingly primitive that they
still think digital watches are a pretty neat idea.
This planet has -- or rather had -- a problem, which was this:
most of the people living on it were unhappy for pretty much of
the time. Many solutions were suggested for this problem, but
most of these were largely concerned with the movements of small
green pieces of paper, which is odd because it wasn't the small
green pieces of paper that were unhappy.
Douglas Adams, `The Hitch Hiker's Guide to the Galaxy'
Valuable services on the Internet are usually _not_ implemented as
mobile agents. There are much simpler ways of implementing services.
All Unix systems provide, for example, the `cron' service. Unix system
users can write a list of tasks to be done each day, each week, twice a
day, or just once. The list is entered into a file named `crontab'.
For example, to distribute a newsletter on a daily basis this way, use
`cron' for calling a script each day early in the morning.
# run at 8 am on weekdays, distribute the newsletter
0 8 * * 1-5 $HOME/bin/daily.job >> $HOME/log/newsletter 2>&1
The script first looks for interesting information on the Internet,
assembles it in a nice form and sends the results via email to the
customers.
The following is an example of a primitive newsletter on stock
market prediction. It is a report which first tries to predict the
change of each share in the Dow Jones Industrial Index for the
particular day. Then it mentions some especially promising shares as
well as some shares which look remarkably bad on that day. The report
ends with the usual disclaimer which tells every child _not_ to try
this at home and hurt anybody.
Good morning Uncle Scrooge,
This is your daily stock market report for Monday, October 16, 2000.
Here are the predictions for today:
AA neutral
GE up
JNJ down
MSFT neutral
...
UTX up
DD down
IBM up
MO down
WMT up
DIS up
INTC up
MRK down
XOM down
EK down
IP down
The most promising shares for today are these:
INTC http://biz.yahoo.com/n/i/intc.html
The stock shares to avoid today are these:
EK http://biz.yahoo.com/n/e/ek.html
IP http://biz.yahoo.com/n/i/ip.html
DD http://biz.yahoo.com/n/d/dd.html
...
The script as a whole is rather long. In order to ease the pain of
studying other people's source code, we have broken the script up into
meaningful parts which are invoked one after the other. The basic
structure of the script is as follows:
BEGIN {
Init()
ReadQuotes()
CleanUp()
Prediction()
Report()
SendMail()
}
The earlier parts store data into variables and arrays which are
subsequently used by later parts of the script. The `Init' function
first checks if the script is invoked correctly (without any
parameters). If not, it informs the user of the correct usage. What
follows are preparations for the retrieval of the historical quote
data. The names of the 30 stock shares are stored in an array `name'
along with the current date in `day', `month', and `year'.
All users who are separated from the Internet by a firewall and have
to direct their Internet accesses to a proxy must supply the name of
the proxy to this script with the `-v Proxy=NAME' option. For most
users, the default proxy and port number should suffice.
function Init() {
if (ARGC != 1) {
print "STOXPRED - daily stock share prediction"
print "IN:\n no parameters, nothing on stdin"
print "PARAM:\n -v Proxy=MyProxy -v ProxyPort=80"
print "OUT:\n commented predictions as email"
print "JK 09.10.2000"
exit
}
# Remember ticker symbols from Dow Jones Industrial Index
StockCount = split("AA GE JNJ MSFT AXP GM JPM PG BA HD KO \
SBC C HON MCD T CAT HWP MMM UTX DD IBM MO WMT DIS INTC \
MRK XOM EK IP", name);
# Remember the current date as the end of the time series
day = strftime("%d")
month = strftime("%m")
year = strftime("%Y")
if (Proxy == "") Proxy = "chart.yahoo.com"
if (ProxyPort == 0) ProxyPort = 80
YahooData = "/inet/tcp/0/" Proxy "/" ProxyPort
}
There are two really interesting parts in the script. One is the
function which reads the historical stock quotes from an Internet
server. The other is the one that does the actual prediction. In the
following function we see how the quotes are read from the Yahoo
server. The data which comes from the server is in CSV format
(comma-separated values):
Date,Open,High,Low,Close,Volume
9-Oct-00,22.75,22.75,21.375,22.375,7888500
6-Oct-00,23.8125,24.9375,21.5625,22,10701100
5-Oct-00,24.4375,24.625,23.125,23.50,5810300
Lines contain values of the same time instant, whereas columns are
separated by commas and contain the kind of data that is described in
the header (first) line. At first, `gawk' is instructed to separate
columns by commas (`FS = ","'). In the loop that follows, a connection
to the Yahoo server is first opened, then a download takes place, and
finally the connection is closed. All this happens once for each ticker
symbol. In the body of this loop, an Internet address is built up as a
string according to the rules of the Yahoo server. The starting and
ending date are chosen to be exactly the same, but one year apart in
the past. All the action is initiated within the `printf' command which
transmits the request for data to the Yahoo server.
In the inner loop, the server's data is first read and then scanned
line by line. Only lines which have six columns and the name of a month
in the first column contain relevant data. This data is stored in the
two-dimensional array `quote'; one dimension being time, the other
being the ticker symbol. During retrieval of the first stock's data,
the calendar names of the time instances are stored in the array `day'
because we need them later.
function ReadQuotes() {
# Retrieve historical data for each ticker symbol
FS = ","
for (stock = 1; stock <= StockCount; stock++) {
URL = "http://chart.yahoo.com/table.csv?s=" name[stock] \
"&a=" month "&b=" day "&c=" year-1 \
"&d=" month "&e=" day "&f=" year \
"g=d&q=q&y=0&z=" name[stock] "&x=.csv"
printf("GET " URL " HTTP/1.0\r\n\r\n") |& YahooData
while ((YahooData |& getline) > 0) {
if (NF == 6 && $1 ~ /Jan|Feb|Mar|Apr|May|Jun|Jul|Aug|Sep|Oct|Nov|Dec/) {
if (stock == 1)
days[++daycount] = $1;
quote[$1, stock] = $5
}
}
close(YahooData)
}
FS = " "
}
Now that we _have_ the data, it can be checked once again to make
sure that no individual stock is missing or invalid, and that all the
stock quotes are aligned correctly. Furthermore, we renumber the time
instances. The most recent day gets day number 1 and all other days get
consecutive numbers. All quotes are rounded toward the nearest whole
number in US Dollars.
function CleanUp() {
# clean up time series; eliminate incomplete data sets
for (d = 1; d <= daycount; d++) {
for (stock = 1; stock <= StockCount; stock++)
if (! ((days[d], stock) in quote))
stock = StockCount + 10
if (stock > StockCount + 1)
continue
datacount++
for (stock = 1; stock <= StockCount; stock++)
data[datacount, stock] = int(0.5 + quote[days[d], stock])
}
delete quote
delete days
}
Now we have arrived at the second really interesting part of the
whole affair. What we present here is a very primitive prediction
algorithm: _If a stock fell yesterday, assume it will also fall today;
if it rose yesterday, assume it will rise today_. (Feel free to
replace this algorithm with a smarter one.) If a stock changed in the
same direction on two consecutive days, this is an indication which
should be highlighted. Two-day advances are stored in `hot' and
two-day declines in `avoid'.
The rest of the function is a sanity check. It counts the number of
correct predictions in relation to the total number of predictions one
could have made in the year before.
function Prediction() {
# Predict each ticker symbol by prolonging yesterday's trend
for (stock = 1; stock <= StockCount; stock++) {
if (data[1, stock] > data[2, stock]) {
predict[stock] = "up"
} else if (data[1, stock] < data[2, stock]) {
predict[stock] = "down"
} else {
predict[stock] = "neutral"
}
if ((data[1, stock] > data[2, stock]) && (data[2, stock] > data[3, stock]))
hot[stock] = 1
if ((data[1, stock] < data[2, stock]) && (data[2, stock] < data[3, stock]))
avoid[stock] = 1
}
# Do a plausibility check: how many predictions proved correct?
for (s = 1; s <= StockCount; s++) {
for (d = 1; d <= datacount-2; d++) {
if (data[d+1, s] > data[d+2, s]) {
UpCount++
} else if (data[d+1, s] < data[d+2, s]) {
DownCount++
} else {
NeutralCount++
}
if (((data[d, s] > data[d+1, s]) && (data[d+1, s] > data[d+2, s])) ||
((data[d, s] < data[d+1, s]) && (data[d+1, s] < data[d+2, s])) ||
((data[d, s] == data[d+1, s]) && (data[d+1, s] == data[d+2, s])))
CorrectCount++
}
}
}
At this point the hard work has been done: the array `predict'
contains the predictions for all the ticker symbols. It is up to the
function `Report' to find some nice words to introduce the desired
information.
function Report() {
# Generate report
report = "\nThis is your daily "
report = report "stock market report for "strftime("%A, %B %d, %Y")".\n"
report = report "Here are the predictions for today:\n\n"
for (stock = 1; stock <= StockCount; stock++)
report = report "\t" name[stock] "\t" predict[stock] "\n"
for (stock in hot) {
if (HotCount++ == 0)
report = report "\nThe most promising shares for today are these:\n\n"
report = report "\t" name[stock] "\t\thttp://biz.yahoo.com/n/" \
tolower(substr(name[stock], 1, 1)) "/" tolower(name[stock]) ".html\n"
}
for (stock in avoid) {
if (AvoidCount++ == 0)
report = report "\nThe stock shares to avoid today are these:\n\n"
report = report "\t" name[stock] "\t\thttp://biz.yahoo.com/n/" \
tolower(substr(name[stock], 1, 1)) "/" tolower(name[stock]) ".html\n"
}
report = report "\nThis sums up to " HotCount+0 " winners and " AvoidCount+0
report = report " losers. When using this kind\nof prediction scheme for"
report = report " the 12 months which lie behind us,\nwe get " UpCount
report = report " 'ups' and " DownCount " 'downs' and " NeutralCount
report = report " 'neutrals'. Of all\nthese " UpCount+DownCount+NeutralCount
report = report " predictions " CorrectCount " proved correct next day.\n"
report = report "A success rate of "\
int(100*CorrectCount/(UpCount+DownCount+NeutralCount)) "%.\n"
report = report "Random choice would have produced a 33% success rate.\n"
report = report "Disclaimer: Like every other prediction of the stock\n"
report = report "market, this report is, of course, complete nonsense.\n"
report = report "If you are stupid enough to believe these predictions\n"
report = report "you should visit a doctor who can treat your ailment."
}
The function `SendMail' goes through the list of customers and opens
a pipe to the `mail' command for each of them. Each one receives an
email message with a proper subject heading and is addressed with his
full name.
function SendMail() {
# send report to customers
customer["uncle.scrooge@ducktown.gov"] = "Uncle Scrooge"
customer["more@utopia.org" ] = "Sir Thomas More"
customer["spinoza@denhaag.nl" ] = "Baruch de Spinoza"
customer["marx@highgate.uk" ] = "Karl Marx"
customer["keynes@the.long.run" ] = "John Maynard Keynes"
customer["bierce@devil.hell.org" ] = "Ambrose Bierce"
customer["laplace@paris.fr" ] = "Pierre Simon de Laplace"
for (c in customer) {
MailPipe = "mail -s 'Daily Stock Prediction Newsletter'" c
print "Good morning " customer[c] "," | MailPipe
print report "\n.\n" | MailPipe
close(MailPipe)
}
}
Be patient when running the script by hand. Retrieving the data for
all the ticker symbols and sending the emails may take several minutes
to complete, depending upon network traffic and the speed of the
available Internet link. The quality of the prediction algorithm is
likely to be disappointing. Try to find a better one. Should you find
one with a success rate of more than 50%, please tell us about it! It
is only for the sake of curiosity, of course. `:-)'
File: gawkinet.info, Node: PROTBASE, Prev: STOXPRED, Up: Some Applications and Techniques
3.10 PROTBASE: Searching Through A Protein Database
===================================================
Hoare's Law of Large Problems: Inside every large problem is a
small problem struggling to get out.
Yahoo's database of stock market data is just one among the many
large databases on the Internet. Another one is located at NCBI
(National Center for Biotechnology Information). Established in 1988 as
a national resource for molecular biology information, NCBI creates
public databases, conducts research in computational biology, develops
software tools for analyzing genome data, and disseminates biomedical
information. In this section, we look at one of NCBI's public services,
which is called BLAST (Basic Local Alignment Search Tool).
You probably know that the information necessary for reproducing
living cells is encoded in the genetic material of the cells. The
genetic material is a very long chain of four base nucleotides. It is
the order of appearance (the sequence) of nucleotides which contains
the information about the substance to be produced. Scientists in
biotechnology often find a specific fragment, determine the nucleotide
sequence, and need to know where the sequence at hand comes from. This
is where the large databases enter the game. At NCBI, databases store
the knowledge about which sequences have ever been found and where they
have been found. When the scientist sends his sequence to the BLAST
service, the server looks for regions of genetic material in its
database which look the most similar to the delivered nucleotide
sequence. After a search time of some seconds or minutes the server
sends an answer to the scientist. In order to make access simple, NCBI
chose to offer their database service through popular Internet
protocols. There are four basic ways to use the so-called BLAST
services:
* The easiest way to use BLAST is through the web. Users may simply
point their browsers at the NCBI home page and link to the BLAST
pages. NCBI provides a stable URL that may be used to perform
BLAST searches without interactive use of a web browser. This is
what we will do later in this section. A demonstration client and
a `README' file demonstrate how to access this URL.
* Currently, `blastcl3' is the standard network BLAST client. You
can download `blastcl3' from the anonymous FTP location.
* BLAST 2.0 can be run locally as a full executable and can be used
to run BLAST searches against private local databases, or
downloaded copies of the NCBI databases. BLAST 2.0 executables may
be found on the NCBI anonymous FTP server.
* The NCBI BLAST Email server is the best option for people without
convenient access to the web. A similarity search can be performed
by sending a properly formatted mail message containing the
nucleotide or protein query sequence to .
The query sequence is compared against the specified database
using the BLAST algorithm and the results are returned in an email
message. For more information on formulating email BLAST searches,
you can send a message consisting of the word "HELP" to the same
address, .
Our starting point is the demonstration client mentioned in the
first option. The `README' file that comes along with the client
explains the whole process in a nutshell. In the rest of this section,
we first show what such requests look like. Then we show how to use
`gawk' to implement a client in about 10 lines of code. Finally, we
show how to interpret the result returned from the service.
Sequences are expected to be represented in the standard IUB/IUPAC
amino acid and nucleic acid codes, with these exceptions: lower-case
letters are accepted and are mapped into upper-case; a single hyphen or
dash can be used to represent a gap of indeterminate length; and in
amino acid sequences, `U' and `*' are acceptable letters (see below).
Before submitting a request, any numerical digits in the query sequence
should either be removed or replaced by appropriate letter codes (e.g.,
`N' for unknown nucleic acid residue or `X' for unknown amino acid
residue). The nucleic acid codes supported are:
A --> adenosine M --> A C (amino)
C --> cytidine S --> G C (strong)
G --> guanine W --> A T (weak)
T --> thymidine B --> G T C
U --> uridine D --> G A T
R --> G A (purine) H --> A C T
Y --> T C (pyrimidine) V --> G C A
K --> G T (keto) N --> A G C T (any)
- gap of indeterminate length
Now you know the alphabet of nucleotide sequences. The last two lines
of the following example query show you such a sequence, which is
obviously made up only of elements of the alphabet just described.
Store this example query into a file named `protbase.request'. You are
now ready to send it to the server with the demonstration client.
PROGRAM blastn
DATALIB month
EXPECT 0.75
BEGIN
>GAWK310 the gawking gene GNU AWK
tgcttggctgaggagccataggacgagagcttcctggtgaagtgtgtttcttgaaatcat
caccaccatggacagcaaa
The actual search request begins with the mandatory parameter
`PROGRAM' in the first column followed by the value `blastn' (the name
of the program) for searching nucleic acids. The next line contains
the mandatory search parameter `DATALIB' with the value `month' for the
newest nucleic acid sequences. The third line contains an optional
`EXPECT' parameter and the value desired for it. The fourth line
contains the mandatory `BEGIN' directive, followed by the query
sequence in FASTA/Pearson format. Each line of information must be
less than 80 characters in length.
The "month" database contains all new or revised sequences released
in the last 30 days and is useful for searching against new sequences.
There are five different blast programs, `blastn' being the one that
compares a nucleotide query sequence against a nucleotide sequence
database.
The last server directive that must appear in every request is the
`BEGIN' directive. The query sequence should immediately follow the
`BEGIN' directive and must appear in FASTA/Pearson format. A sequence
in FASTA/Pearson format begins with a single-line description. The
description line, which is required, is distinguished from the lines of
sequence data that follow it by having a greater-than (`>') symbol in
the first column. For the purposes of the BLAST server, the text of
the description is arbitrary.
If you prefer to use a client written in `gawk', just store the
following 10 lines of code into a file named `protbase.awk' and use
this client instead. Invoke it with `gawk -f protbase.awk
protbase.request'. Then wait a minute and watch the result coming in.
In order to replicate the demonstration client's behaviour as closely
as possible, this client does not use a proxy server. We could also
have extended the client program in *note Retrieving Web Pages: GETURL,
to implement the client request from `protbase.awk' as a special case.
{ request = request "\n" $0 }
END {
BLASTService = "/inet/tcp/0/www.ncbi.nlm.nih.gov/80"
printf "POST /cgi-bin/BLAST/nph-blast_report HTTP/1.0\n" |& BLASTService
printf "Content-Length: " length(request) "\n\n" |& BLASTService
printf request |& BLASTService
while ((BLASTService |& getline) > 0)
print $0
close(BLASTService)
}
The demonstration client from NCBI is 214 lines long (written in C)
and it is not immediately obvious what it does. Our client is so short
that it _is_ obvious what it does. First it loops over all lines of the
query and stores the whole query into a variable. Then the script
establishes an Internet connection to the NCBI server and transmits the
query by framing it with a proper HTTP request. Finally it receives and
prints the complete result coming from the server.
Now, let us look at the result. It begins with an HTTP header, which
you can ignore. Then there are some comments about the query having been
filtered to avoid spuriously high scores. After this, there is a
reference to the paper that describes the software being used for
searching the data base. After a repetition of the original query's
description we find the list of significant alignments:
Sequences producing significant alignments: (bits) Value
gb|AC021182.14|AC021182 Homo sapiens chromosome 7 clone RP11-733... 38 0.20
gb|AC021056.12|AC021056 Homo sapiens chromosome 3 clone RP11-115... 38 0.20
emb|AL160278.10|AL160278 Homo sapiens chromosome 9 clone RP11-57... 38 0.20
emb|AL391139.11|AL391139 Homo sapiens chromosome X clone RP11-35... 38 0.20
emb|AL365192.6|AL365192 Homo sapiens chromosome 6 clone RP3-421H... 38 0.20
emb|AL138812.9|AL138812 Homo sapiens chromosome 11 clone RP1-276... 38 0.20
gb|AC073881.3|AC073881 Homo sapiens chromosome 15 clone CTD-2169... 38 0.20
This means that the query sequence was found in seven human
chromosomes. But the value 0.20 (20%) means that the probability of an
accidental match is rather high (20%) in all cases and should be taken
into account. You may wonder what the first column means. It is a key
to the specific database in which this occurrence was found. The
unique sequence identifiers reported in the search results can be used
as sequence retrieval keys via the NCBI server. The syntax of sequence
header lines used by the NCBI BLAST server depends on the database from
which each sequence was obtained. The table below lists the
identifiers for the databases from which the sequences were derived.
Database Name Identifier Syntax
============================ ========================
GenBank gb|accession|locus
EMBL Data Library emb|accession|locus
DDBJ, DNA Database of Japan dbj|accession|locus
NBRF PIR pir||entry
Protein Research Foundation prf||name
SWISS-PROT sp|accession|entry name
Brookhaven Protein Data Bank pdb|entry|chain
Kabat's Sequences of Immuno... gnl|kabat|identifier
Patents pat|country|number
GenInfo Backbone Id bbs|number
For example, an identifier might be `gb|AC021182.14|AC021182', where
the `gb' tag indicates that the identifier refers to a GenBank sequence,
`AC021182.14' is its GenBank ACCESSION, and `AC021182' is the GenBank
LOCUS. The identifier contains no spaces, so that a space indicates
the end of the identifier.
Let us continue in the result listing. Each of the seven alignments
mentioned above is subsequently described in detail. We will have a
closer look at the first of them.
>gb|AC021182.14|AC021182 Homo sapiens chromosome 7 clone RP11-733N23, WORKING DRAFT SEQUENCE, 4
unordered pieces
Length = 176383
Score = 38.2 bits (19), Expect = 0.20
Identities = 19/19 (100%)
Strand = Plus / Plus
Query: 35 tggtgaagtgtgtttcttg 53
|||||||||||||||||||
Sbjct: 69786 tggtgaagtgtgtttcttg 69804
This alignment was located on the human chromosome 7. The fragment
on which part of the query was found had a total length of 176383. Only
19 of the nucleotides matched and the matching sequence ran from
character 35 to 53 in the query sequence and from 69786 to 69804 in the
fragment on chromosome 7. If you are still reading at this point, you
are probably interested in finding out more about Computational Biology
and you might appreciate the following hints.
1. There is a book called `Introduction to Computational Biology' by
Michael S. Waterman, which is worth reading if you are seriously
interested. You can find a good book review on the Internet.
2. While Waterman's book can explain to you the algorithms employed
internally in the database search engines, most practitioners
prefer to approach the subject differently. The applied side of
Computational Biology is called Bioinformatics, and emphasizes the
tools available for day-to-day work as well as how to actually
_use_ them. One of the very few affordable books on Bioinformatics
is `Developing Bioinformatics Computer Skills'.
3. The sequences _gawk_ and _gnuawk_ are in widespread use in the
genetic material of virtually every earthly living being. Let us
take this as a clear indication that the divine creator has
intended `gawk' to prevail over other scripting languages such as
`perl', `tcl', or `python' which are not even proper sequences.
(:-)
File: gawkinet.info, Node: Links, Next: GNU Free Documentation License, Prev: Some Applications and Techniques, Up: Top
4 Related Links
***************
This section lists the URLs for various items discussed in this major
node. They are presented in the order in which they appear.
`Internet Programming with Python'
`http://www.fsbassociates.com/books/python.htm'
`Advanced Perl Programming'
`http://www.oreilly.com/catalog/advperl'
`Web Client Programming with Perl'
`http://www.oreilly.com/catalog/webclient'
Richard Stevens's home page and book
`http://www.kohala.com/~rstevens'
The SPAK home page
`http://www.userfriendly.net/linux/RPM/contrib/libc6/i386/spak-0.6b-1.i386.html'
Volume III of `Internetworking with TCP/IP', by Comer and Stevens
`http://www.cs.purdue.edu/homes/dec/tcpip3s.cont.html'
XBM Graphics File Format
`http://www.wotsit.org/download.asp?f=xbm'
GNUPlot
`http://www.cs.dartmouth.edu/gnuplot_info.html'
Mark Humphrys' Eliza page
`http://www.compapp.dcu.ie/~humphrys/eliza.html'
Yahoo! Eliza Information
`http://dir.yahoo.com/Recreation/Games/Computer_Games/Internet_Games/Web_Games/Artificial_Intelligence'
Java versions of Eliza
`http://www.tjhsst.edu/Psych/ch1/eliza.html'
Java versions of Eliza with source code
`http://home.adelphia.net/~lifeisgood/eliza/eliza.htm'
Eliza Programs with Explanations
`http://chayden.net/chayden/eliza/Eliza.shtml'
Loebner Contest
`http://acm.org/~loebner/loebner-prize.htmlx'
Tck/Tk Information
`http://www.scriptics.com/'
Intel 80x86 Processors
`http://developer.intel.com/design/platform/embedpc/what_is.htm'
AMD Elan Processors
`http://www.amd.com/products/epd/processors/4.32bitcont/32bitcont/index.html'
XINU
`http://willow.canberra.edu.au/~chrisc/xinu.html'
GNU/Linux
`http://uclinux.lineo.com/'
Embedded PCs
`http://dir.yahoo.com/Business_and_Economy/Business_to_Business/Computers/Hardware/Embedded_Control/'
MiniSQL
`http://www.hughes.com.au/library/'
Market Share Surveys
`http://www.netcraft.com/survey'
`Numerical Recipes in C: The Art of Scientific Computing'
`http://www.nr.com'
VRML
`http://www.vrml.org'
The VRML FAQ
`http://www.vrml.org/technicalinfo/specifications/specifications.htm#FAQ'
The UMBC Agent Web
`http://www.cs.umbc.edu/agents'
Apache Web Server
`http://www.apache.org'
National Center for Biotechnology Information (NCBI)
`http://www.ncbi.nlm.nih.gov'
Basic Local Alignment Search Tool (BLAST)
`http://www.ncbi.nlm.nih.gov/BLAST/blast_overview.html'
NCBI Home Page
`http://www.ncbi.nlm.nih.gov'
BLAST Pages
`http://www.ncbi.nlm.nih.gov/BLAST'
BLAST Demonstration Client
`ftp://ncbi.nlm.nih.gov/blast/blasturl/'
BLAST anonymous FTP location
`ftp://ncbi.nlm.nih.gov/blast/network/netblast/'
BLAST 2.0 Executables
`ftp://ncbi.nlm.nih.gov/blast/executables/'
IUB/IUPAC Amino Acid and Nucleic Acid Codes
`http://www.uthscsa.edu/geninfo/blastmail.html#item6'
FASTA/Pearson Format
`http://www.ncbi.nlm.nih.gov/BLAST/fasta.html'
Fasta/Pearson Sequence in Java
`http://www.kazusa.or.jp/java/codon_table_java/'
Book Review of `Introduction to Computational Biology'
`http://www.acm.org/crossroads/xrds5-1/introcb.html'
`Developing Bioinformatics Computer Skills'
`http://www.oreilly.com/catalog/bioskills/'
File: gawkinet.info, Node: GNU Free Documentation License, Next: Index, Prev: Links, Up: Top
GNU Free Documentation License
******************************
Version 1.2, November 2002
Copyright (C) 2000,2001,2002 Free Software Foundation, Inc.
51 Franklin Street, Fifth Floor, Boston, MA 02110-1301, USA
Everyone is permitted to copy and distribute verbatim copies
of this license document, but changing it is not allowed.
0. PREAMBLE
The purpose of this License is to make a manual, textbook, or other
functional and useful document "free" in the sense of freedom: to
assure everyone the effective freedom to copy and redistribute it,
with or without modifying it, either commercially or
noncommercially. Secondarily, this License preserves for the
author and publisher a way to get credit for their work, while not
being considered responsible for modifications made by others.
This License is a kind of "copyleft", which means that derivative
works of the document must themselves be free in the same sense.
It complements the GNU General Public License, which is a copyleft
license designed for free software.
We have designed this License in order to use it for manuals for
free software, because free software needs free documentation: a
free program should come with manuals providing the same freedoms
that the software does. But this License is not limited to
software manuals; it can be used for any textual work, regardless
of subject matter or whether it is published as a printed book.
We recommend this License principally for works whose purpose is
instruction or reference.
1. APPLICABILITY AND DEFINITIONS
This License applies to any manual or other work, in any medium,
that contains a notice placed by the copyright holder saying it
can be distributed under the terms of this License. Such a notice
grants a world-wide, royalty-free license, unlimited in duration,
to use that work under the conditions stated herein. The
"Document", below, refers to any such manual or work. Any member
of the public is a licensee, and is addressed as "you". You
accept the license if you copy, modify or distribute the work in a
way requiring permission under copyright law.
A "Modified Version" of the Document means any work containing the
Document or a portion of it, either copied verbatim, or with
modifications and/or translated into another language.
A "Secondary Section" is a named appendix or a front-matter section
of the Document that deals exclusively with the relationship of the
publishers or authors of the Document to the Document's overall
subject (or to related matters) and contains nothing that could
fall directly within that overall subject. (Thus, if the Document
is in part a textbook of mathematics, a Secondary Section may not
explain any mathematics.) The relationship could be a matter of
historical connection with the subject or with related matters, or
of legal, commercial, philosophical, ethical or political position
regarding them.
The "Invariant Sections" are certain Secondary Sections whose
titles are designated, as being those of Invariant Sections, in
the notice that says that the Document is released under this
License. If a section does not fit the above definition of
Secondary then it is not allowed to be designated as Invariant.
The Document may contain zero Invariant Sections. If the Document
does not identify any Invariant Sections then there are none.
The "Cover Texts" are certain short passages of text that are
listed, as Front-Cover Texts or Back-Cover Texts, in the notice
that says that the Document is released under this License. A
Front-Cover Text may be at most 5 words, and a Back-Cover Text may
be at most 25 words.
A "Transparent" copy of the Document means a machine-readable copy,
represented in a format whose specification is available to the
general public, that is suitable for revising the document
straightforwardly with generic text editors or (for images
composed of pixels) generic paint programs or (for drawings) some
widely available drawing editor, and that is suitable for input to
text formatters or for automatic translation to a variety of
formats suitable for input to text formatters. A copy made in an
otherwise Transparent file format whose markup, or absence of
markup, has been arranged to thwart or discourage subsequent
modification by readers is not Transparent. An image format is
not Transparent if used for any substantial amount of text. A
copy that is not "Transparent" is called "Opaque".
Examples of suitable formats for Transparent copies include plain
ASCII without markup, Texinfo input format, LaTeX input format,
SGML or XML using a publicly available DTD, and
standard-conforming simple HTML, PostScript or PDF designed for
human modification. Examples of transparent image formats include
PNG, XCF and JPG. Opaque formats include proprietary formats that
can be read and edited only by proprietary word processors, SGML or
XML for which the DTD and/or processing tools are not generally
available, and the machine-generated HTML, PostScript or PDF
produced by some word processors for output purposes only.
The "Title Page" means, for a printed book, the title page itself,
plus such following pages as are needed to hold, legibly, the
material this License requires to appear in the title page. For
works in formats which do not have any title page as such, "Title
Page" means the text near the most prominent appearance of the
work's title, preceding the beginning of the body of the text.
A section "Entitled XYZ" means a named subunit of the Document
whose title either is precisely XYZ or contains XYZ in parentheses
following text that translates XYZ in another language. (Here XYZ
stands for a specific section name mentioned below, such as
"Acknowledgements", "Dedications", "Endorsements", or "History".)
To "Preserve the Title" of such a section when you modify the
Document means that it remains a section "Entitled XYZ" according
to this definition.
The Document may include Warranty Disclaimers next to the notice
which states that this License applies to the Document. These
Warranty Disclaimers are considered to be included by reference in
this License, but only as regards disclaiming warranties: any other
implication that these Warranty Disclaimers may have is void and
has no effect on the meaning of this License.
2. VERBATIM COPYING
You may copy and distribute the Document in any medium, either
commercially or noncommercially, provided that this License, the
copyright notices, and the license notice saying this License
applies to the Document are reproduced in all copies, and that you
add no other conditions whatsoever to those of this License. You
may not use technical measures to obstruct or control the reading
or further copying of the copies you make or distribute. However,
you may accept compensation in exchange for copies. If you
distribute a large enough number of copies you must also follow
the conditions in section 3.
You may also lend copies, under the same conditions stated above,
and you may publicly display copies.
3. COPYING IN QUANTITY
If you publish printed copies (or copies in media that commonly
have printed covers) of the Document, numbering more than 100, and
the Document's license notice requires Cover Texts, you must
enclose the copies in covers that carry, clearly and legibly, all
these Cover Texts: Front-Cover Texts on the front cover, and
Back-Cover Texts on the back cover. Both covers must also clearly
and legibly identify you as the publisher of these copies. The
front cover must present the full title with all words of the
title equally prominent and visible. You may add other material
on the covers in addition. Copying with changes limited to the
covers, as long as they preserve the title of the Document and
satisfy these conditions, can be treated as verbatim copying in
other respects.
If the required texts for either cover are too voluminous to fit
legibly, you should put the first ones listed (as many as fit
reasonably) on the actual cover, and continue the rest onto
adjacent pages.
If you publish or distribute Opaque copies of the Document
numbering more than 100, you must either include a
machine-readable Transparent copy along with each Opaque copy, or
state in or with each Opaque copy a computer-network location from
which the general network-using public has access to download
using public-standard network protocols a complete Transparent
copy of the Document, free of added material. If you use the
latter option, you must take reasonably prudent steps, when you
begin distribution of Opaque copies in quantity, to ensure that
this Transparent copy will remain thus accessible at the stated
location until at least one year after the last time you
distribute an Opaque copy (directly or through your agents or
retailers) of that edition to the public.
It is requested, but not required, that you contact the authors of
the Document well before redistributing any large number of
copies, to give them a chance to provide you with an updated
version of the Document.
4. MODIFICATIONS
You may copy and distribute a Modified Version of the Document
under the conditions of sections 2 and 3 above, provided that you
release the Modified Version under precisely this License, with
the Modified Version filling the role of the Document, thus
licensing distribution and modification of the Modified Version to
whoever possesses a copy of it. In addition, you must do these
things in the Modified Version:
A. Use in the Title Page (and on the covers, if any) a title
distinct from that of the Document, and from those of
previous versions (which should, if there were any, be listed
in the History section of the Document). You may use the
same title as a previous version if the original publisher of
that version gives permission.
B. List on the Title Page, as authors, one or more persons or
entities responsible for authorship of the modifications in
the Modified Version, together with at least five of the
principal authors of the Document (all of its principal
authors, if it has fewer than five), unless they release you
from this requirement.
C. State on the Title page the name of the publisher of the
Modified Version, as the publisher.
D. Preserve all the copyright notices of the Document.
E. Add an appropriate copyright notice for your modifications
adjacent to the other copyright notices.
F. Include, immediately after the copyright notices, a license
notice giving the public permission to use the Modified
Version under the terms of this License, in the form shown in
the Addendum below.
G. Preserve in that license notice the full lists of Invariant
Sections and required Cover Texts given in the Document's
license notice.
H. Include an unaltered copy of this License.
I. Preserve the section Entitled "History", Preserve its Title,
and add to it an item stating at least the title, year, new
authors, and publisher of the Modified Version as given on
the Title Page. If there is no section Entitled "History" in
the Document, create one stating the title, year, authors,
and publisher of the Document as given on its Title Page,
then add an item describing the Modified Version as stated in
the previous sentence.
J. Preserve the network location, if any, given in the Document
for public access to a Transparent copy of the Document, and
likewise the network locations given in the Document for
previous versions it was based on. These may be placed in
the "History" section. You may omit a network location for a
work that was published at least four years before the
Document itself, or if the original publisher of the version
it refers to gives permission.
K. For any section Entitled "Acknowledgements" or "Dedications",
Preserve the Title of the section, and preserve in the
section all the substance and tone of each of the contributor
acknowledgements and/or dedications given therein.
L. Preserve all the Invariant Sections of the Document,
unaltered in their text and in their titles. Section numbers
or the equivalent are not considered part of the section
titles.
M. Delete any section Entitled "Endorsements". Such a section
may not be included in the Modified Version.
N. Do not retitle any existing section to be Entitled
"Endorsements" or to conflict in title with any Invariant
Section.
O. Preserve any Warranty Disclaimers.
If the Modified Version includes new front-matter sections or
appendices that qualify as Secondary Sections and contain no
material copied from the Document, you may at your option
designate some or all of these sections as invariant. To do this,
add their titles to the list of Invariant Sections in the Modified
Version's license notice. These titles must be distinct from any
other section titles.
You may add a section Entitled "Endorsements", provided it contains
nothing but endorsements of your Modified Version by various
parties--for example, statements of peer review or that the text
has been approved by an organization as the authoritative
definition of a standard.
You may add a passage of up to five words as a Front-Cover Text,
and a passage of up to 25 words as a Back-Cover Text, to the end
of the list of Cover Texts in the Modified Version. Only one
passage of Front-Cover Text and one of Back-Cover Text may be
added by (or through arrangements made by) any one entity. If the
Document already includes a cover text for the same cover,
previously added by you or by arrangement made by the same entity
you are acting on behalf of, you may not add another; but you may
replace the old one, on explicit permission from the previous
publisher that added the old one.
The author(s) and publisher(s) of the Document do not by this
License give permission to use their names for publicity for or to
assert or imply endorsement of any Modified Version.
5. COMBINING DOCUMENTS
You may combine the Document with other documents released under
this License, under the terms defined in section 4 above for
modified versions, provided that you include in the combination
all of the Invariant Sections of all of the original documents,
unmodified, and list them all as Invariant Sections of your
combined work in its license notice, and that you preserve all
their Warranty Disclaimers.
The combined work need only contain one copy of this License, and
multiple identical Invariant Sections may be replaced with a single
copy. If there are multiple Invariant Sections with the same name
but different contents, make the title of each such section unique
by adding at the end of it, in parentheses, the name of the
original author or publisher of that section if known, or else a
unique number. Make the same adjustment to the section titles in
the list of Invariant Sections in the license notice of the
combined work.
In the combination, you must combine any sections Entitled
"History" in the various original documents, forming one section
Entitled "History"; likewise combine any sections Entitled
"Acknowledgements", and any sections Entitled "Dedications". You
must delete all sections Entitled "Endorsements."
6. COLLECTIONS OF DOCUMENTS
You may make a collection consisting of the Document and other
documents released under this License, and replace the individual
copies of this License in the various documents with a single copy
that is included in the collection, provided that you follow the
rules of this License for verbatim copying of each of the
documents in all other respects.
You may extract a single document from such a collection, and
distribute it individually under this License, provided you insert
a copy of this License into the extracted document, and follow
this License in all other respects regarding verbatim copying of
that document.
7. AGGREGATION WITH INDEPENDENT WORKS
A compilation of the Document or its derivatives with other
separate and independent documents or works, in or on a volume of
a storage or distribution medium, is called an "aggregate" if the
copyright resulting from the compilation is not used to limit the
legal rights of the compilation's users beyond what the individual
works permit. When the Document is included an aggregate, this
License does not apply to the other works in the aggregate which
are not themselves derivative works of the Document.
If the Cover Text requirement of section 3 is applicable to these
copies of the Document, then if the Document is less than one half
of the entire aggregate, the Document's Cover Texts may be placed
on covers that bracket the Document within the aggregate, or the
electronic equivalent of covers if the Document is in electronic
form. Otherwise they must appear on printed covers that bracket
the whole aggregate.
8. TRANSLATION
Translation is considered a kind of modification, so you may
distribute translations of the Document under the terms of section
4. Replacing Invariant Sections with translations requires special
permission from their copyright holders, but you may include
translations of some or all Invariant Sections in addition to the
original versions of these Invariant Sections. You may include a
translation of this License, and all the license notices in the
Document, and any Warranty Disclaimers, provided that you also
include the original English version of this License and the
original versions of those notices and disclaimers. In case of a
disagreement between the translation and the original version of
this License or a notice or disclaimer, the original version will
prevail.
If a section in the Document is Entitled "Acknowledgements",
"Dedications", or "History", the requirement (section 4) to
Preserve its Title (section 1) will typically require changing the
actual title.
9. TERMINATION
You may not copy, modify, sublicense, or distribute the Document
except as expressly provided for under this License. Any other
attempt to copy, modify, sublicense or distribute the Document is
void, and will automatically terminate your rights under this
License. However, parties who have received copies, or rights,
from you under this License will not have their licenses
terminated so long as such parties remain in full compliance.
10. FUTURE REVISIONS OF THIS LICENSE
The Free Software Foundation may publish new, revised versions of
the GNU Free Documentation License from time to time. Such new
versions will be similar in spirit to the present version, but may
differ in detail to address new problems or concerns. See
`http://www.gnu.org/copyleft/'.
Each version of the License is given a distinguishing version
number. If the Document specifies that a particular numbered
version of this License "or any later version" applies to it, you
have the option of following the terms and conditions either of
that specified version or of any later version that has been
published (not as a draft) by the Free Software Foundation. If
the Document does not specify a version number of this License,
you may choose any version ever published (not as a draft) by the
Free Software Foundation.
ADDENDUM: How to use this License for your documents
====================================================
To use this License in a document you have written, include a copy of
the License in the document and put the following copyright and license
notices just after the title page:
Copyright (C) YEAR YOUR NAME.
Permission is granted to copy, distribute and/or modify this document
under the terms of the GNU Free Documentation License, Version 1.2
or any later version published by the Free Software Foundation;
with no Invariant Sections, no Front-Cover Texts, and no Back-Cover Texts.
A copy of the license is included in the section entitled ``GNU
Free Documentation License''.
If you have Invariant Sections, Front-Cover Texts and Back-Cover
Texts, replace the "with...Texts." line with this:
with the Invariant Sections being LIST THEIR TITLES, with
the Front-Cover Texts being LIST, and with the Back-Cover Texts
being LIST.
If you have Invariant Sections without Cover Texts, or some other
combination of the three, merge those two alternatives to suit the
situation.
If your document contains nontrivial examples of program code, we
recommend releasing these examples in parallel under your choice of
free software license, such as the GNU General Public License, to
permit their use in free software.
File: gawkinet.info, Node: Index, Prev: GNU Free Documentation License, Up: Top
Index
*****
[index ]
* Menu:
* /inet/ files (gawk): Gawk Special Files. (line 34)
* /inet/raw special files (gawk): File /inet/raw. (line 6)
* /inet/tcp special files (gawk): File /inet/tcp. (line 6)
* /inet/udp special files (gawk): File /inet/udp. (line 6)
* advanced features, network connections: Troubleshooting. (line 6)
* agent <1>: MOBAGWHO. (line 6)
* agent: Challenges. (line 76)
* AI: Challenges. (line 76)
* apache <1>: MOBAGWHO. (line 42)
* apache: WEBGRAB. (line 72)
* Bioinformatics: PROTBASE. (line 227)
* BLAST, Basic Local Alignment Search Tool: PROTBASE. (line 6)
* blocking: Making Connections. (line 35)
* Boutell, Thomas: STATIST. (line 6)
* CGI (Common Gateway Interface): MOBAGWHO. (line 42)
* CGI (Common Gateway Interface), dynamic web pages and: Web page.
(line 46)
* CGI (Common Gateway Interface), library: CGI Lib. (line 11)
* clients: Making Connections. (line 21)
* Clinton, Bill: Challenges. (line 59)
* Common Gateway Interface, See CGI: Web page. (line 46)
* Computational Biology: PROTBASE. (line 227)
* contest: Challenges. (line 6)
* cron utility: STOXPRED. (line 23)
* CSV format: STOXPRED. (line 128)
* dark corner, RAW protocol: File /inet/raw. (line 13)
* Dow Jones Industrial Index: STOXPRED. (line 44)
* ELIZA program: Simple Server. (line 11)
* email: Email. (line 11)
* FASTA/Pearson format: PROTBASE. (line 102)
* FDL (Free Documentation License): GNU Free Documentation License.
(line 6)
* filenames, for network access: Gawk Special Files. (line 29)
* files, /inet/ (gawk): Gawk Special Files. (line 34)
* files, /inet/raw (gawk): File /inet/raw. (line 6)
* files, /inet/tcp (gawk): File /inet/tcp. (line 6)
* files, /inet/udp (gawk): File /inet/udp. (line 6)
* finger utility: Setting Up. (line 22)
* Free Documentation License (FDL): GNU Free Documentation License.
(line 6)
* FTP (File Transfer Protocol): Basic Protocols. (line 29)
* gawk, networking: Using Networking. (line 6)
* gawk, networking, connections <1>: TCP Connecting. (line 6)
* gawk, networking, connections: Special File Fields. (line 49)
* gawk, networking, filenames: Gawk Special Files. (line 29)
* gawk, networking, See Also email: Email. (line 6)
* gawk, networking, service, establishing: Setting Up. (line 6)
* gawk, networking, troubleshooting: Caveats. (line 6)
* gawk, web and, See web service: Interacting Service. (line 6)
* getline command: TCP Connecting. (line 11)
* GETURL program: GETURL. (line 6)
* GIF image format <1>: STATIST. (line 6)
* GIF image format: Web page. (line 46)
* GNU Free Documentation License: GNU Free Documentation License.
(line 6)
* GNU/Linux <1>: REMCONF. (line 6)
* GNU/Linux <2>: Interacting. (line 27)
* GNU/Linux: Troubleshooting. (line 54)
* GNUPlot utility <1>: STATIST. (line 6)
* GNUPlot utility: Interacting Service. (line 189)
* Hoare, C.A.R. <1>: PROTBASE. (line 6)
* Hoare, C.A.R.: MOBAGWHO. (line 6)
* hostname field: Special File Fields. (line 29)
* HTML (Hypertext Markup Language): Web page. (line 30)
* HTTP (Hypertext Transfer Protocol) <1>: Web page. (line 6)
* HTTP (Hypertext Transfer Protocol): Basic Protocols. (line 29)
* HTTP (Hypertext Transfer Protocol), record separators and: Web page.
(line 30)
* HTTP server, core logic: Interacting Service. (line 6)
* Humphrys, Mark: Simple Server. (line 179)
* Hypertext Markup Language (HTML): Web page. (line 30)
* Hypertext Transfer Protocol, See HTTP: Web page. (line 6)
* image format: STATIST. (line 6)
* images, in web pages: Interacting Service. (line 189)
* images, retrieving over networks: Web page. (line 46)
* input/output, two-way, See Also gawk, networking: Gawk Special Files.
(line 19)
* Internet, See networks: Interacting. (line 48)
* JavaScript: STATIST. (line 56)
* Linux <1>: REMCONF. (line 6)
* Linux <2>: Interacting. (line 27)
* Linux: Troubleshooting. (line 54)
* Lisp: MOBAGWHO. (line 98)
* localport field: Gawk Special Files. (line 34)
* Loebner, Hugh: Challenges. (line 6)
* Loui, Ronald: Challenges. (line 76)
* MAZE: MAZE. (line 6)
* Microsoft Windows: WEBGRAB. (line 43)
* Microsoft Windows, networking: Troubleshooting. (line 54)
* Microsoft Windows, networking, ports: Setting Up. (line 37)
* MiniSQL: REMCONF. (line 111)
* MOBAGWHO program: MOBAGWHO. (line 6)
* NCBI, National Center for Biotechnology Information: PROTBASE.
(line 6)
* networks, gawk and: Using Networking. (line 6)
* networks, gawk and, connections <1>: TCP Connecting. (line 6)
* networks, gawk and, connections: Special File Fields. (line 49)
* networks, gawk and, filenames: Gawk Special Files. (line 29)
* networks, gawk and, See Also email: Email. (line 6)
* networks, gawk and, service, establishing: Setting Up. (line 6)
* networks, gawk and, troubleshooting: Caveats. (line 6)
* networks, ports, reserved: Setting Up. (line 37)
* networks, ports, specifying: Special File Fields. (line 18)
* networks, See Also web pages: PANIC. (line 6)
* Numerical Recipes: STATIST. (line 24)
* ORS variable, HTTP and: Web page. (line 30)
* ORS variable, POP and: Email. (line 36)
* PANIC program: PANIC. (line 6)
* Perl: Using Networking. (line 14)
* Perl, gawk networking and: Using Networking. (line 24)
* Perlis, Alan: MAZE. (line 6)
* pipes, networking and: TCP Connecting. (line 30)
* PNG image format <1>: STATIST. (line 6)
* PNG image format: Web page. (line 46)
* POP (Post Office Protocol): Email. (line 6)
* Post Office Protocol (POP): Email. (line 6)
* PostScript: STATIST. (line 138)
* PROLOG: Challenges. (line 76)
* PROTBASE: PROTBASE. (line 6)
* protocol field: Special File Fields. (line 11)
* PS image format: STATIST. (line 6)
* Python: Using Networking. (line 14)
* Python, gawk networking and: Using Networking. (line 24)
* RAW protocol: File /inet/raw. (line 6)
* record separators, HTTP and: Web page. (line 30)
* record separators, POP and: Email. (line 36)
* REMCONF program: REMCONF. (line 6)
* remoteport field: Gawk Special Files. (line 34)
* robot <1>: WEBGRAB. (line 6)
* robot: Challenges. (line 85)
* RS variable, HTTP and: Web page. (line 30)
* RS variable, POP and: Email. (line 36)
* servers <1>: Setting Up. (line 22)
* servers: Making Connections. (line 14)
* servers, as hosts: Special File Fields. (line 29)
* servers, HTTP: Interacting Service. (line 6)
* servers, web: Simple Server. (line 6)
* Simple Mail Transfer Protocol (SMTP): Email. (line 6)
* SMTP (Simple Mail Transfer Protocol) <1>: Email. (line 6)
* SMTP (Simple Mail Transfer Protocol): Basic Protocols. (line 29)
* SPAK utility: File /inet/raw. (line 21)
* STATIST program: STATIST. (line 6)
* STOXPRED program: STOXPRED. (line 6)
* synchronous communications: Making Connections. (line 35)
* Tcl/Tk: Using Networking. (line 14)
* Tcl/Tk, gawk and <1>: Some Applications and Techniques.
(line 22)
* Tcl/Tk, gawk and: Using Networking. (line 24)
* TCP (Transmission Control Protocol) <1>: File /inet/tcp. (line 6)
* TCP (Transmission Control Protocol): Using Networking. (line 29)
* TCP (Transmission Control Protocol), connection, establishing: TCP Connecting.
(line 6)
* TCP (Transmission Control Protocol), UDP and: Interacting. (line 48)
* TCP/IP, protocols, selecting: Special File Fields. (line 11)
* TCP/IP, sockets and: Gawk Special Files. (line 19)
* Transmission Control Protocol, See TCP: Using Networking. (line 29)
* troubleshooting, gawk, networks: Caveats. (line 6)
* troubleshooting, networks, connections: Troubleshooting. (line 6)
* troubleshooting, networks, timeouts: Caveats. (line 18)
* UDP (User Datagram Protocol): File /inet/udp. (line 6)
* UDP (User Datagram Protocol), TCP and: Interacting. (line 48)
* Unix, network ports and: Setting Up. (line 37)
* URLCHK program: URLCHK. (line 6)
* User Datagram Protocol, See UDP: File /inet/udp. (line 6)
* vertical bar (|), |& operator (I/O): TCP Connecting. (line 25)
* VRML: MAZE. (line 6)
* web browsers, See web service: Interacting Service. (line 6)
* web pages: Web page. (line 6)
* web pages, images in: Interacting Service. (line 189)
* web pages, retrieving: GETURL. (line 6)
* web servers: Simple Server. (line 6)
* web service <1>: PANIC. (line 6)
* web service: Primitive Service. (line 6)
* WEBGRAB program: WEBGRAB. (line 6)
* Weizenbaum, Joseph: Simple Server. (line 11)
* XBM image format: Interacting Service. (line 189)
* Yahoo! <1>: STOXPRED. (line 6)
* Yahoo!: REMCONF. (line 6)
* | (vertical bar), |& operator (I/O): TCP Connecting. (line 25)
Tag Table:
Node: Top2007
Node: Preface5697
Node: Introduction7072
Node: Stream Communications8098
Node: Datagram Communications9271
Node: The TCP/IP Protocols10902
Ref: The TCP/IP Protocols-Footnote-111586
Node: Basic Protocols11743
Node: Ports13065
Node: Making Connections14470
Ref: Making Connections-Footnote-117051
Ref: Making Connections-Footnote-217098
Node: Using Networking17279
Node: Gawk Special Files19633
Node: Special File Fields21637
Ref: table-inet-components25387
Node: Comparing Protocols27299
Node: File /inet/tcp27888
Node: File /inet/udp28914
Node: File /inet/raw30035
Ref: File /inet/raw-Footnote-133068
Node: TCP Connecting33148
Node: Troubleshooting35486
Ref: Troubleshooting-Footnote-138537
Node: Interacting39081
Node: Setting Up41811
Node: Email45305
Node: Web page47631
Ref: Web page-Footnote-150436
Node: Primitive Service50633
Node: Interacting Service53367
Ref: Interacting Service-Footnote-162496
Node: CGI Lib62528
Node: Simple Server69489
Ref: Simple Server-Footnote-177219
Node: Caveats77320
Node: Challenges78463
Node: Some Applications and Techniques87130
Node: PANIC89587
Node: GETURL91305
Node: REMCONF93928
Node: URLCHK99404
Node: WEBGRAB103239
Node: STATIST107689
Ref: STATIST-Footnote-1119397
Node: MAZE119842
Node: MOBAGWHO126030
Ref: MOBAGWHO-Footnote-1139974
Node: STOXPRED140029
Node: PROTBASE154284
Node: Links167366
Node: GNU Free Documentation License170800
Node: Index193204
End Tag Table